Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-2146784

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-2146784 URS0000173A33_9483

26 nucleotides
1 database (PirBase)
Found in 7 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAUCCUUGGAACCUAGGUGUGAGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Bos taurus (cattle) Bta-Mir-362-P1_5p (mature (co-guide))
Canis lupus familiaris Cfa-Mir-362-P1_5p (mature (guide))
Cricetulus griseus (Chinese hamster) cgr-miR-362
Homo sapiens (human) Hsa-Mir-362-P1_5p (mature (guide))
Macaca mulatta (Rhesus monkey) Mml-Mir-362-P1_5p (mature (guide))
Rattus norvegicus Rattus_norvegicus piRNA piR-rno-2964451
Sus scrofa Sus_scrofa piRNA piR-ssc-749495