Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-15a precursor secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-15a precursor URS0000171CD1_9913

Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Bos taurus. Annotated by 3 databases (ENA, RefSeq, miRBase). Described in 7 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-15, RF00455). Bos taurus (cattle) microRNA bta-mir-15a precursor sequence is a product of MIR15A, 15a, mir-15a precurso, bta-mir-15a precursor, mir-15a, mir-15a precursor, 15 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 67 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Aotus nancymaae miRNA (ENSANAG00000002507.1)
    3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-15a precursor
    4. Capra hircus (Goat) microRNA mir-15a (ENSCHIG00000009473.1)
    5. Carlito syrichta miRNA (ENSTSYG00000020886.2)
    6. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000009933.1)
    7. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000015366.1)
    8. Colobus angolensis palliatus miRNA (ENSCANG00000007738.1)
    9. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000034390.1)
    10. Gorilla gorilla gorilla ggo-mir-15a (ENSGGOG00000032089.2)
    11. Gorilla gorilla (western gorilla) microRNA ggo-mir-15a precursor
    12. Homo sapiens microRNA hsa-mir-15a precursor
    13. Lagothrix lagotricha microRNA lla-mir-15a precursor
    14. Lemur catta microRNA lca-mir-15a precursor
    15. Macaca fascicularis (Crab-eating macaque) miRNA
    16. Macaca mulatta microRNA mml-mir-15a precursor
    17. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-15a precursor
    18. Mandrillus leucophaeus miRNA (ENSMLEG00000004472.1)
    19. Microcebus murinus miRNA (ENSMICG00000019256.3)
    20. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000023170.1)
    21. Nomascus leucogenys miRNA (ENSNLEG00000021690.2)
    22. Ochotona princeps (American pika) miRNA (ENSOPRG00000018090.1, ENSOPRG00000019082.1)
    23. Otolemur garnettii miRNA (ENSOGAG00000017565.1)
    24. Ovis aries miRNA (ENSOARG00000024593.1)
    25. Pan paniscus microRNA ppa-mir-15a precursor
    26. Panthera pardus microRNA 15a (ENSPPRG00000014041.1)
    27. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002517.1)
    28. Pan troglodytes (chimpanzee) microRNA ptr-mir-15a precursor
    29. Papio anubis (Olive baboon) miRNA (ENSPANG00000001874.2)
    30. Pongo abelii microRNA 15a (ENSPPYG00000021062.1)
    31. Pongo pygmaeus microRNA ppy-mir-15a precursor
    32. Procavia capensis miRNA (ENSPCAG00000019494.1)
    33. Propithecus coquereli miRNA (ENSPCOG00000011562.1)
    34. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007554.1)
    35. Rhinopithecus roxellana miRNA (ENSRROG00000017782.1)
    36. Saguinus labiatus microRNA sla-mir-15a precursor
    37. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000018432.1)
    38. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017805.1)
    39. Tursiops truncatus miRNA (ENSTTRG00000022017.1)
    2D structure New