Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-15a precursor URS0000171CD1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-15a: Hsa-mir-15a is a member of the hsa-mir-15 family cluster and has been identified as a tumor suppressor. It regulates the expression of oncogenes BCL2, CCND1, and WNT3, thereby inhibiting tumor growth [PMC5814839]. Hsa-mir-15a targets a total of 56 genes, including CCND1 [PMC5814839]. Hsa-miR-16, another member of the hsa-mir-15 family cluster, targets 63 genes including CCND1 [PMC5355656]. Hsa-miR-155 targets 20 genes, including CCND1 and SMAD2 [PMC5355656]. Hsa-miR-375 targets 44 genes, including AKT2 and CDK6 [PMC5355656]. Lastly, hsa-miR-429 targets 59 genes, including CCND1 [PMC5355656]. Among these microRNAs in the regulatory network studied, hsa-miR-16 targets the highest number of genes [PMC5355656]. In conclusion, hsa-mir-15a is a tumor suppressor that regulates oncogenes BCL2, CCND1 and WNT3. It is part of the hsa-mir-15 family cluster and has been shown to target 56 genes. Other microRNAs in this cluster such as hsa-miR16 also target CCND1 but target different numbers of total genes in the regulatory network studied. These findings highlight the importance of microRNAs in cancer regulation and provide potential therapeutic targets for cancer treatment.

MIR15A: MIR15A is a microRNA that is part of the minimally deleted region, along with MIR16, which negatively regulates BCL2 expression levels [PMC10080996]. In human liver cancer tissues, the expression of MIR15A is negatively associated with HULC and PTEN [PMC5998602].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002507.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-15a precursor
  3. Bos taurus microRNA bta-mir-15a precursor
  4. Capra hircus (Goat) microRNA mir-15a (ENSCHIG00000009473.1)
  5. Carlito syrichta miRNA (ENSTSYG00000020886.2)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 15a (ENSCCAG00000004160.1)
  7. Cercocebus atys miRNA (ENSCATG00000009933.1)
  8. Choloepus hoffmanni miRNA (ENSCHOG00000015366.1)
  9. Colobus angolensis palliatus miRNA (ENSCANG00000007738.1)
  10. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000034390.1)
  11. Gorilla gorilla gorilla ggo-mir-15a (ENSGGOG00000032089.2)
  12. Gorilla gorilla microRNA ggo-mir-15a precursor
  13. Lagothrix lagotricha microRNA lla-mir-15a precursor
  14. Lemur catta microRNA lca-mir-15a precursor
  15. Macaca mulatta microRNA mml-mir-15a precursor
  16. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-15a precursor
  17. Mandrillus leucophaeus miRNA (ENSMLEG00000004472.1)
  18. Microcebus murinus microRNA 15a (ENSMICG00000019256.3)
  19. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000023170.1)
  20. Nomascus leucogenys microRNA 15a (ENSNLEG00000021690.2)
  21. Ochotona princeps (American pika) miRNA (ENSOPRG00000018090.1, ENSOPRG00000019082.1)
  22. Otolemur garnettii miRNA (ENSOGAG00000017565.1)
  23. Ovis aries miRNA (ENSOARG00000024593.1)
  24. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-15a precursor
  25. Panthera pardus microRNA 15a (ENSPPRG00000014041.1)
  26. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002517.1)
  27. Pan troglodytes microRNA ptr-mir-15a precursor
  28. Pongo abelii (Sumatran orangutan) miRNA
  29. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-15a precursor
  30. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019494.1)
  31. Propithecus coquereli miRNA (ENSPCOG00000011562.1)
  32. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007554.1)
  33. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000017782.1)
  34. Saguinus labiatus microRNA sla-mir-15a precursor
  35. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000018432.1)
  36. Tupaia belangeri miRNA (ENSTBEG00000017805.1)
  37. Tursiops truncatus miRNA (ENSTTRG00000022017.1)
Publications