Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) microRNA ptr-mir-15a precursor URS0000171CD1_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000002507.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-15a precursor
  3. Bos taurus microRNA bta-mir-15a precursor
  4. Capra hircus (Goat) microRNA mir-15a (ENSCHIG00000009473.1)
  5. Carlito syrichta miRNA (ENSTSYG00000020886.2)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 15a (ENSCCAG00000004160.1)
  7. Cercocebus atys miRNA (ENSCATG00000009933.1)
  8. Choloepus hoffmanni miRNA (ENSCHOG00000015366.1)
  9. Colobus angolensis palliatus miRNA (ENSCANG00000007738.1)
  10. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000034390.1)
  11. Gorilla gorilla gorilla ggo-mir-15a (ENSGGOG00000032089.2)
  12. Gorilla gorilla microRNA ggo-mir-15a precursor
  13. Homo sapiens microRNA hsa-mir-15a precursor
  14. Lagothrix lagotricha microRNA lla-mir-15a precursor
  15. Lemur catta microRNA lca-mir-15a precursor
  16. Macaca mulatta microRNA mml-mir-15a precursor
  17. Macaca nemestrina (pig-tailed macaque) microRNA mne-mir-15a precursor
  18. Mandrillus leucophaeus miRNA (ENSMLEG00000004472.1)
  19. Microcebus murinus microRNA 15a (ENSMICG00000019256.3)
  20. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000023170.1)
  21. Nomascus leucogenys microRNA 15a (ENSNLEG00000021690.2)
  22. Ochotona princeps (American pika) miRNA (ENSOPRG00000018090.1, ENSOPRG00000019082.1)
  23. Otolemur garnettii miRNA (ENSOGAG00000017565.1)
  24. Ovis aries miRNA (ENSOARG00000024593.1)
  25. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-15a precursor
  26. Panthera pardus microRNA 15a (ENSPPRG00000014041.1)
  27. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002517.1)
  28. Pongo abelii (Sumatran orangutan) miRNA
  29. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-15a precursor
  30. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019494.1)
  31. Propithecus coquereli miRNA (ENSPCOG00000011562.1)
  32. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000007554.1)
  33. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000017782.1)
  34. Saguinus labiatus microRNA sla-mir-15a precursor
  35. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000018432.1)
  36. Tupaia belangeri miRNA (ENSTBEG00000017805.1)
  37. Tursiops truncatus miRNA (ENSTTRG00000022017.1)
Publications