Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-15a precursor URS0000171CD1_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 50 other species

  1. Ailuropoda melanoleuca (giant panda) mir-15 microRNA precursor family
  2. Aotus nancymaae miRNA (ENSANAG00000002507.1)
  3. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-15a precursor
  4. Bos taurus (cattle) microRNA bta-mir-15a precursor
  5. Callithrix jacchus (white-tufted-ear marmoset) mir-15 microRNA precursor family
  6. Canis lupus familiaris (dog) mir-15 microRNA precursor family
  7. Capra hircus (Goat) microRNA mir-15a (ENSCHIG00000009473.1)
  8. Carlito syrichta miRNA (ENSTSYG00000020886.2)
  9. Cavia porcellus (Domestic guinea pig) mir-15 microRNA precursor family
  10. Cebus imitator (Panamanian white-faced capuchin) microRNA 15a (ENSCCAG00000004160.1)
  11. Cercocebus atys miRNA (ENSCATG00000009933.1)
  12. Chlorocebus sabaeus mir-15 microRNA precursor family
  13. Choloepus hoffmanni (Hoffmann's two-fingered sloth) miRNA (ENSCHOG00000015366.1)
  14. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000007738.1)
  15. Dasypus novemcinctus (nine-banded armadillo) miRNA (ENSDNOG00000034390.1)
  16. Dipodomys ordii (Ord's kangaroo rat) mir-15 microRNA precursor family
  17. Equus caballus (horse) mir-15 microRNA precursor family
  18. Felis catus (domestic cat) mir-15 microRNA precursor family
  19. Fukomys damarensis (Damara mole-rat) mir-15 microRNA precursor family
  20. Gorilla gorilla gorilla ggo-mir-15a (ENSGGOG00000032089.2)
  21. Gorilla gorilla microRNA ggo-mir-15a precursor
  22. Heterocephalus glaber (naked mole-rat) mir-15 microRNA precursor family
  23. Homo sapiens (human) microRNA hsa-mir-15a precursor
  24. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-15a precursor
  25. Lemur catta microRNA lca-mir-15a precursor
  26. Macaca mulatta (Rhesus monkey) microRNA mml-mir-15a precursor
  27. Macaca nemestrina microRNA mne-mir-15a precursor
  28. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004472.1)
  29. Microcebus murinus microRNA 15a (ENSMICG00000019256.3)
  30. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000023170.1)
  31. Nomascus leucogenys microRNA 15a (ENSNLEG00000021690.2)
  32. Ochotona princeps miRNA (ENSOPRG00000018090.1, ENSOPRG00000019082.1)
  33. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017565.1)
  34. Ovis aries miRNA (ENSOARG00000024593.1)
  35. Panthera pardus microRNA 15a (ENSPPRG00000014041.1)
  36. Panthera tigris altaica miRNA (ENSPTIG00000002517.1)
  37. Pan troglodytes microRNA ptr-mir-15a precursor
  38. Papio anubis (Olive baboon) mir-15 microRNA precursor family
  39. Pongo abelii (Sumatran orangutan) mir-15 microRNA precursor family
  40. Pongo pygmaeus microRNA ppy-mir-15a precursor
  41. Procavia capensis miRNA (ENSPCAG00000019494.1)
  42. Propithecus coquereli miRNA (ENSPCOG00000011562.1)
  43. Rhinopithecus bieti miRNA (ENSRBIG00000007554.1)
  44. Rhinopithecus roxellana miRNA (ENSRROG00000017782.1)
  45. Saguinus labiatus microRNA sla-mir-15a precursor
  46. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000018432.1)
  47. Ictidomys tridecemlineatus Spermophilus tridecemlineatus (thirteen-lined ground squirrel) mir-15 microRNA precursor family
  48. Tupaia belangeri (northern tree shrew) miRNA (ENSTBEG00000017805.1)
  49. Tupaia chinensis (Chinese tree shrew) mir-15 microRNA precursor family
  50. Tursiops truncatus (bottlenosed dolphin) miRNA (ENSTTRG00000022017.1)