Drosophila sechellia (Fruit fly) snRNA Dsec\snRNA:U5:1

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

$Drosophila sechellia (Fruit fly) snRNA Dsec\snRNA:U5:1 secondary structure diagram$

Drosophila sechellia (Fruit fly) snRNA Dsec\snRNA:U5:1 URS0000171987_7238

123 nucleotides
2 databases (ENA, Ensembl Metazoa)
Found in 3 other species
1. sncRNA
2. snRNA
3. u5 snRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUCUGGUUUCUCUUCAAUUGUCGAAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAGGAACACUCUAAUGAGUCUAAAAUAAUUUUUAGUAGUGCCCUGUCGCAAGACUGGGGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Drosophila erecta (Fruit fly) snRNA Dere\snRNA:U5:3
Drosophila melanogaster (fruit fly) small nuclear RNA U5 at 63BC (Dmel_CR32908)
Drosophila simulans snRNA:U5:6

2D structure