v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cebus imitator (Panamanian white-faced capuchin) microRNA 200c (ENSCCAG00000005388.1) secondary structure diagram

Cebus imitator (Panamanian white-faced capuchin) microRNA 200c (ENSCCAG00000005388.1) URS0000171525_2715852

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Aotus nancymaae miRNA (ENSANAG00000002917.1)
  2. Cercocebus atys miRNA (ENSCATG00000010068.1)
  3. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000008048.1)
  4. Gorilla gorilla gorilla ggo-mir-200c (ENSGGOG00000031226.2)
  5. Homo sapiens microRNA hsa-mir-200c precursor
  6. Macaca mulatta (Rhesus monkey) microRNA mml-mir-200c precursor
  7. Macaca nemestrina miRNA (ENSMNEG00000011018.1)
  8. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000004780.1)
  9. Nomascus leucogenys microRNA 200c (ENSNLEG00000020384.2)
  10. Pan paniscus microRNA 200c (ENSPPAG00000007531.1)
  11. Pan troglodytes microRNA mir-200c (ENSPTRG00000039790.2)
  12. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000036854.1)
  13. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021444.2)
  14. Pongo pygmaeus microRNA ppy-mir-200c precursor
  15. Rhinopithecus bieti miRNA (ENSRBIG00000007915.1)
  16. Rhinopithecus roxellana miRNA (ENSRROG00000011131.1)
  17. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000020212.1)
 2D structure Publications