Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3677-3p URS0000171020_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3677: Hsa-mir-3677 is a miRNA that has been studied in the context of liver hepatocellular carcinoma (LIHC) and hepatocellular carcinoma (HCC) patients. It has been found to be one of the significant miRNAs associated with overall survival (OS) in LIHC patients with low and high tumor mutational burden (TMB) [PMC7355149]. Additionally, hsa-mir-3677 has been shown to be significantly correlated with overall survival in HCC patients [PMC8992476]. Studies have predicted the target genes of hsa-mir-3677 using mirDB and WGCNA [PMC8298461]. Furthermore, targeting SphK1 via hsa-mir-3677 has been demonstrated to inhibit the progression of human osteosarcoma cells [PMC9838007]. However, there is limited research on the functions of hsa-mir-3677 in human cells [PMC9838007]. Hsa-mir-3677 is one of the top five miRNAs associated with overall survival in HCC patients [PMC6003936]. It is worth noting that other miRNAs, such as miR-21, hsa-miR-26a, and hsa-miR-101, have also shown potential for improving detection of HCC [PMC9367234]. Additionally, specific binding positions for hsa-mir-3677 have been identified among NS1 genes in dengue types 2 and 3 [PMC3521223]. References: [PMC7355149] [PMC4457814] [PMC8992476] [PMC8298461] [PMC9838007] [PMC6003936] [PM9367234] [PM3521223]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCGUGGGCUCUGGCCACGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications