v19

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-221-3p URS0000170CF4_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MalaCards, IntAct, PSICQUIC, RefSeq, LncBase, MirGeneDB, miRBase, GeneCards, ENA, TarBase). Described in 105 papers. Homo sapiens (human) hsa-miR-221-3p sequence is a product of MIR221, hsa-miR-221, miR-221-3p, miR-221, hsa-miR-221-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3GAMMA, 14-3-3γ, 2H9, 80K-L, 9G8, A-myb, A121, A170, ABCC5.

Interactions 105

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-221-3p interacts with:

Interaction id Participant Synonyms
EBI-20560188 intact:EBI-20560169 EBI-20560169 ENST00000366787.7 mrna_thbs2
EBI-20560354 intact:EBI-20560169 EBI-20560169 ENST00000366787.7 mrna_thbs2
EBI-20564903 intact:EBI-20564913 EBI-20564913 ENST00000440973.5 mrna_er alfa
EBI-25421345 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
URS0000170CF4_9606-0 O14543 O14543
URS0000170CF4_9606-53 O14543 O14543
URS0000170CF4_9606-1 O14727 O14727
URS0000170CF4_9606-54 O14727 O14727
URS0000170CF4_9606-55 O15524 O15524
URS0000170CF4_9606-2 O15524 O15524
URS0000170CF4_9606-3 O43524 O43524
URS0000170CF4_9606-56 O43524 O43524
URS0000170CF4_9606-57 O60238 O60238
URS0000170CF4_9606-4 O60238 O60238
URS0000170CF4_9606-5 O60315 O60315
URS0000170CF4_9606-58 O60315 O60315
URS0000170CF4_9606-59 O95661 O95661
URS0000170CF4_9606-6 O95661 O95661
URS0000170CF4_9606-60 O95980 O95980
URS0000170CF4_9606-7 O95980 O95980
URS0000170CF4_9606-8 P01100 P01100
URS0000170CF4_9606-61 P01100 P01100
URS0000170CF4_9606-62 P04083 P04083
URS0000170CF4_9606-9 P04083 P04083
URS0000170CF4_9606-10 P05362 P05362
URS0000170CF4_9606-64 P05362 P05362
URS0000170CF4_9606-49 P05362 P05362
URS0000170CF4_9606-63 P05362 P05362
URS0000170CF4_9606-65 P06400 P06400
URS0000170CF4_9606-11 P06400 P06400
URS0000170CF4_9606-12 P09067 P09067
URS0000170CF4_9606-66 P09067 P09067
URS0000170CF4_9606-67 P10243 P10243
URS0000170CF4_9606-13 P10243 P10243
URS0000170CF4_9606-16 P10721 P10721
URS0000170CF4_9606-14 P10721 P10721
URS0000170CF4_9606-15 P10721 P10721
URS0000170CF4_9606-17 P10721 P10721
URS0000170CF4_9606-18 P10721 P10721
URS0000170CF4_9606-68 P10721 P10721
URS0000170CF4_9606-69 P10721 P10721
URS0000170CF4_9606-71 P14921 P14921
URS0000170CF4_9606-19 P14921 P14921
URS0000170CF4_9606-20 P14921 P14921
URS0000170CF4_9606-70 P14921 P14921
URS0000170CF4_9606-72 P16144 P16144
URS0000170CF4_9606-21 P16144 P16144
URS0000170CF4_9606-22 P16455 P16455
URS0000170CF4_9606-73 P16455 P16455
URS0000170CF4_9606-74 P17302 P17302
URS0000170CF4_9606-23 P17302 P17302
URS0000170CF4_9606-24 P30291 P30291
URS0000170CF4_9606-75 P30291 P30291
URS0000170CF4_9606-50 P35625 P35625
URS0000170CF4_9606-76 P35625 P35625
URS0000170CF4_9606-77 P42229 P42229
URS0000170CF4_9606-25 P42229 P42229
URS0000170CF4_9606-29 P46527 P46527
URS0000170CF4_9606-51 P46527 P46527
URS0000170CF4_9606-80 P46527 P46527
URS0000170CF4_9606-78 P46527 P46527
URS0000170CF4_9606-28 P46527 P46527
URS0000170CF4_9606-27 P46527 P46527
URS0000170CF4_9606-26 P46527 P46527
URS0000170CF4_9606-79 P46527 P46527
URS0000170CF4_9606-30 P49711 P49711
URS0000170CF4_9606-81 P49711 P49711
URS0000170CF4_9606-33 P49918 P49918
URS0000170CF4_9606-31 P49918 P49918
URS0000170CF4_9606-32 P49918 P49918
URS0000170CF4_9606-82 P49918 P49918
URS0000170CF4_9606-83 P49918 P49918
URS0000170CF4_9606-84 P49918 P49918
URS0000170CF4_9606-85 P60484 P60484
URS0000170CF4_9606-34 P60484 P60484
URS0000170CF4_9606-35 P62820 P62820
URS0000170CF4_9606-86 P62820 P62820
URS0000170CF4_9606-87 P78536 P78536
URS0000170CF4_9606-36 P78536 P78536
URS0000170CF4_9606-88 Q00987 Q00987
URS0000170CF4_9606-37 Q00987 Q00987
URS0000170CF4_9606-38 Q06787 Q06787
URS0000170CF4_9606-89 Q06787 Q06787
URS0000170CF4_9606-39 Q13153 Q13153
URS0000170CF4_9606-90 Q13153 Q13153
URS0000170CF4_9606-40 Q5U5R9 Q5U5R9
URS0000170CF4_9606-91 Q5U5R9 Q5U5R9
URS0000170CF4_9606-92 Q96LC9 Q96LC9
URS0000170CF4_9606-52 Q96LC9 Q96LC9
URS0000170CF4_9606-93 Q9BXH1 Q9BXH1
URS0000170CF4_9606-41 Q9BXH1 Q9BXH1
URS0000170CF4_9606-94 Q9HBE4 Q9HBE4
URS0000170CF4_9606-42 Q9HBE4 Q9HBE4
URS0000170CF4_9606-95 Q9NQC7 Q9NQC7
URS0000170CF4_9606-43 Q9NQC7 Q9NQC7
URS0000170CF4_9606-44 Q9NS37 Q9NS37
URS0000170CF4_9606-96 Q9NS37 Q9NS37
URS0000170CF4_9606-45 Q9NX09 Q9NX09
URS0000170CF4_9606-97 Q9NX09 Q9NX09
URS0000170CF4_9606-46 Q9UBU2 Q9UBU2
URS0000170CF4_9606-98 Q9UBU2 Q9UBU2
URS0000170CF4_9606-99 Q9UHD2 Q9UHD2
URS0000170CF4_9606-47 Q9UHD2 Q9UHD2
URS0000170CF4_9606-100 Q9UHF7 Q9UHF7
URS0000170CF4_9606-48 Q9UHF7 Q9UHF7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset 

    AGCUACAUUGUCUGCUGGGUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 77 other species

    1. Alligator mississippiensis ami-miR-221-3p
    2. Anolis carolinensis Aca-Mir-221-P1_3p (mature (guide))
    3. Bos taurus (cattle) Bta-Mir-221-P1_3p (mature (guide))
    4. Canis lupus familiaris Cfa-Mir-221-P1_3p (mature (guide))
    5. Capra hircus miR-221
    6. Cavia porcellus (domestic guinea pig) cpo-miR-221-3p
    7. Cervus elaphus (red deer) cel-miR-221
    8. Chrysemys picta bellii Cpi-Mir-221-P1_3p* (star (passenger))
    9. Columba livia (rock pigeon) Cli-Mir-221-P1_3p (mature (guide))
    10. Cricetulus griseus cgr-miR-221-3p
    11. Danio rerio (zebrafish) dre-miR-221-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-221-3p
    13. Daubentonia madagascariensis (aye-aye) dma-miR-221
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-221-P1_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-221
    16. Gallus gallus (chicken) gga-miR-221-3p
    17. Gorilla gorilla (western gorilla) ggo-miR-221
    18. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-221
    19. Macaca mulatta mml-miR-221-3p
    20. Maylandia zebra mze-miR-221
    21. Microcebus murinus mmr-miR-221
    22. Monodelphis domestica mdo-miR-221-3p
    23. Mus musculus (house mouse) mmu-miR-221-3p
    24. Neolamprologus brichardi nbr-miR-221
    25. Nomascus leucogenys nle-miR-221
    26. Ophiophagus hannah oha-miR-221-3p
    27. Oreochromis niloticus oni-miR-221
    28. Ornithorhynchus anatinus Oan-Mir-221-P1_3p* (star (passenger))
    29. Oryctolagus cuniculus (rabbit) ocu-miR-221-3p
    30. Oryzias latipes (Japanese medaka) ola-miR-221
    31. Otolemur garnettii oga-miR-221
    32. Ovis aries miscellaneous RNA
    33. Pan paniscus ppa-miR-221
    34. Pan troglodytes (chimpanzee) ptr-miR-221
    35. Papio hamadryas (hamadryas baboon) pha-miR-221
    36. Pongo pygmaeus ppy-miR-221
    37. Pundamilia nyererei pny-miR-221
    38. Rattus norvegicus rno-miR-221-3p
    39. Saimiri boliviensis boliviensis sbo-miR-221
    40. Sarcophilus harrisii Sha-Mir-221-P1_3p (mature (guide))
    41. Scyliorhinus torazame (cloudy catshark) Sto-Mir-221-P1_3p* (star (passenger))
    42. Taeniopygia guttata (zebra finch) tgu-miR-221-3p
    43. Takifugu rubripes (torafugu) fru-miR-221
    44. Tetraodon nigroviridis tni-miR-221
    45. Tor tambroides miR-221-3p
    46. Xenopus tropicalis xtr-miR-221