Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-263a-3p URS000016D62E_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-263a: Dme-mir-263a is a Drosophila miRNA that was studied using Pandan sensors [PMC4889923]. In an experiment, it was observed that dme-mir-263a, along with dme-miR-263b, exhibited strong circadian regulation [PMC4813163]. The circadian fluctuations in the expression of dme-mir-263a and dme-miR-263b were detected in wild type flies and were significantly reduced in the arrhythmic clock mutant cyc01 [PMC8847441]. The 5' end of dme-mir-263a showed no significant homology with other fly miRNAs [PMC2486268]. The oscillations of both dme-mir-263a and -263b were confirmed using quantitative RT-PCR (qRT-PCR) and were found to persist in constant dark conditions [PMC2263044]. Dme-miR-124 showed a similar expression pattern to that of dme-mir-263a and -263b, with trough levels during mid-day followed by increases during the early to late-night [PMC2263044]. Only dme-mir-263a and -263b exhibited statistically significant daily abundance changes in wild type flies using the ANOVA with 5% FDR test [PMC2263044]. The mature sequence for miR-183 in vertebrates is similar to that of both D. melanogaster dme-mir-263a and miR-263b [PMC2263044].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGUGAUCUCUUAGUGGCAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cochliomyia macellaria mature cma-miR-263a-3p
  2. Drosophila virilis dvi-miR-263a-3p
Publications