Caenorhabditis elegans cel-miR-39-5p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans cel-miR-39-5p URS000016D303_6239

22 nucleotides
4 databases (ENA, miRBase, RefSeq, WormBase)
Found in 0 other species
556 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-mir-39: To eliminate differences among samples, synthetic Caenorhabditis elegans cel-mir-39, which has no homologous gene in humans, was added into each sample [PMC4013415]. At 2 h post delivery, no significant differences were detected in cel-mir-39 levels between samples taken from the whole right caudal lobe and distal tip of the left lobe, irrespective of the delivery method [PMC5835931].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGCUGAUUUCGUCUUGGUAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications