v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SIRT1 regulating lncRNA tumor promoter (SIRLNT) URS000016D1BD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SIRLNT: SIRLNT is a long non-coding RNA (lncRNA) that predominantly participates in DNA looping [PMC8682742]. In a study, SIRLNT was identified as one of the differentially expressed genes in breast cancer (BCa) [PMC8177463]. It was classified as an increased-risk gene, along with MNX1-AS1, AC092920.1, AC105219.1, and AL355312.3 [PMC8177463]. SIRLNT, along with AC092920.1 and AC055854.1, was found to be independently correlated with overall survival (OS) in BCa patients [PMC8177463]. Furthermore, an 8-lncRNA-based signature that included SIRLNT was constructed and validated to predict BCa patient survival outcomes and migration of BCa cells [PMC8177463]. In another study focusing on neuroendocrine tumors (NETs), SIRLNT was identified as one of the 10 NETs-associated lncRNAs [PMC9676361]. Using LASSO regression analysis, a prognostic signature containing SIRLNT along with AL365181.3, FAM83A-AS1, and AJ003147.2 was developed for NETs patients [PMC9676361]. Additionally, SIRLNT has been found to act as a tumor promoter in breast cancer by regulating miR-4766-5p [PMC9676361]. References: - PMC8682742 - PMC8177463 - PMC9676361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGGUGACUGAAACCACACGCCAUGUUGGGAGACUUCCAAACAAGUCUAGAGAGUUGGCACUUAGGGAUGAAGAAAUCAUCUUCUGGGUACACUUGGUCUUUCCUGAUGACGCUUUUAAGAGAAAGGCAGAGUUGACCCUGGGCUUUCAAAAAACUGUUCUUUCAGGCAAAACCUCAGAGAGAACUGGCUGCUAGUGAUCCUCUGCAGAGACCUUGAAGAGCACGGCAAUUAUGAAACUUCAACAAGAAAAGAUUUAAGCUGAUCUUUUAAAAAAAUAUAUACUGUCAGGAAUUUUGUAGAAAUGACUUUAAUGUAAUAACUGCUUCUUUGACUUAUGUUUUGUCUUGUGGUGAAAAGAAAAAUAUUUAUAAAAGCAUGCCUGUGUCCUAAAAUUGGGGACACAAACUUAAAUGACUGAAGGCACUUGAGGAGUGGAGGCAAGGAUGGUGAAACCAGGCCCUGUACCAAGCAGGAGAGCGUGAACCUGCUAAAGAGAGUGACUGCUUCUCAUUUCCAGUCAAUGCGACUGGUGUCGCAUUCCAGUCAAAUGGAGUUGCGACACCAUUUCAGCCACAGCGAUUGAUCUGGAUUUUCUGUAAAAUUCCCUGAUUUUUACAUAUUGCCAAUUAAUUAAUUAAUUAAAAAGAAAUGUAGAUGUUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications