Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-101 precursor URS000016B83E_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCCAUUCUAAAGGUACAGUACUGUGAUAACUGAAGGAUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 49 other species

  1. Ailuropoda melanoleuca mir-101 microRNA precursor family
  2. Aotus nancymaae (Ma's night monkey) microRNA 101-1 (ENSANAG00000008775.1)
  3. Bos taurus mir-101 microRNA precursor family
  4. Callithrix jacchus mir-101 microRNA precursor family
  5. Camelus ferus (Wild Bactrian camel) mir-101 microRNA precursor family
  6. Canis lupus familiaris (dog) mir-101 microRNA precursor family
  7. Capra hircus chi-mir-101 (ENSCHIG00000000840.1)
  8. Cebus imitator (Panamanian white-faced capuchin) microRNA 101-1 (ENSCCAG00000020139.1)
  9. Cercocebus atys microRNA 101-1 (ENSCATG00000012157.1)
  10. Chlorocebus sabaeus mir-101 microRNA precursor family
  11. Colobus angolensis palliatus miRNA (ENSCANG00000007134.1)
  12. Dipodomys ordii mir-101 microRNA precursor family
  13. Eptesicus fuscus (big brown bat) mir-101 microRNA precursor family
  14. Felis catus mir-101 microRNA precursor family
  15. Gorilla gorilla gorilla ggo-mir-101 (ENSGGOG00000031890.2)
  16. Gorilla gorilla (western gorilla) microRNA ggo-mir-101 precursor
  17. Lagothrix lagotricha microRNA lla-mir-101 precursor
  18. Loxodonta africana mir-101 microRNA precursor family
  19. Macaca mulatta microRNA mml-mir-101 precursor (mml-mir-101-1)
  20. Macaca nemestrina microRNA mne-mir-101 precursor
  21. Mandrillus leucophaeus microRNA 101-1 (ENSMLEG00000010316.1)
  22. Mesocricetus auratus (golden hamster) mir-101 microRNA precursor family
  23. Microcebus murinus (gray mouse lemur) microRNA 101-1 (ENSMICG00000018947.3)
  24. Mus musculus mir-101 microRNA precursor family
  25. Mustela putorius furo mir-101 microRNA precursor family
  26. Myotis brandtii mir-101 microRNA precursor family
  27. Myotis davidii mir-101 microRNA precursor family
  28. Myotis lucifugus mir-101 microRNA precursor family
  29. Neotoma lepida (desert woodrat) mir-101 microRNA precursor family
  30. Nomascus leucogenys microRNA 101-1 (ENSNLEG00000023244.2)
  31. Ornithorhynchus anatinus (platypus) mir-101 microRNA precursor family
  32. Oryctolagus cuniculus (rabbit) mir-101 microRNA precursor family
  33. Ovis aries (sheep) mir-101 microRNA precursor family
  34. Panthera pardus (leopard) microRNA 101-1 (ENSPPRG00000013857.1)
  35. Panthera tigris altaica (Tiger) microRNA 101-1 (ENSPTIG00000002844.1)
  36. Pan troglodytes microRNA ptr-mir-101 precursor (ptr-mir-101-1)
  37. Papio anubis (Olive baboon) mir-101 microRNA precursor family
  38. Pongo abelii mir-101 microRNA precursor family
  39. Pongo pygmaeus microRNA ppy-mir-101 precursor (ppy-mir-101-1)
  40. Propithecus coquereli microRNA 101-1 (ENSPCOG00000000897.1)
  41. Pteropus alecto (black flying fox) mir-101 microRNA precursor family
  42. Rattus norvegicus microRNA rno-mir-101a precursor
  43. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 101-1 (ENSRBIG00000019065.1)
  44. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 101-1 (ENSRROG00000038120.1)
  45. Saguinus labiatus microRNA sla-mir-101 precursor
  46. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 101-1 (ENSSBOG00000019366.1)
  47. Ictidomys tridecemlineatus mir-101 microRNA precursor family
  48. Sus scrofa mir-101 microRNA precursor family
  49. Tupaia chinensis (Chinese tree shrew) mir-101 microRNA precursor family
Publications