Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 62 (SNORA62) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 62 (SNORA62) URS00001696A6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA62: SNORA62 is a small nucleolar RNA (snoRNA) that has been studied in relation to prostate cancer. It is one of the inferred genes that lacks affirmative evidence of its association with prostate cancer [PMC2718658]. In a gene expression analysis, SNORA62 was found in the turquoise module along with two other long non-coding RNAs (lncRNAs), TP53TG1 and RPPH1 [PMC8116958]. Additionally, SNORA62 and SNORA64 were found to be differentially expressed in two age comparisons, suggesting that their expression levels change with age [PMC3636386]. SNORA62 is the sponge orthologue of the human SNORA62 (E2) [PMC4515611]. It has been observed that part of the RPSA intron 4, which contains SNORA62, is present in the RPSAP8 and RPSAP9 pseudogenes [PMC2850357]. In studies on sno/scaRNA profiles in leukemia, dysregulated snoRNAs including SNORD109A, SNORD64, SNORD107, SNORD116-18, SNORA31, SNORA6, and SNORA62 have been identified. Some of these dysregulated snoRNAs have been associated with shorter progression-free survival for chronic lymphocytic leukemia patients [PMC8975097]. The potential modulation of apoptotic effects by SNORA62 on its host genes may offer new strategies for targeting FAU [PMC4515611].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGCACAUUGUUAGAGCUUGGAGUUGAGGCUACUGACUGGCCGAUGAACUCGCAAGUGUAGGUAGUGUGCUACAUGAGGGGCAAGUUUUCGCUAACACCACAAGGGUCUCUGGCCCAAUGAGUGGAGUUUGAUAGUAAUUCUUGCUACAAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications