Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGAUGAACAUAGCAAGGUGGUCCCACUCCUUCCCAUCCCGAACAGGACAGUGAAACACCUUAGCGCCGAUGAUAGUGGGUGGACACCUGUGAAAGUAGGUCAUCGUCAAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.