v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Clostridium sp. NJ4 5S ribosomal RNA secondary structure diagram

Clostridium sp. NJ4 5S ribosomal RNA URS0000163277_2126737

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCGGUGACCAUAGCUUGGUUGUAACACCCGUUCCCAUACCGAACACGAAGGUUAAGAACCAAAGCGCCGAUGGUACUGCAGGGGCAGCCCUGUGGGAGAGUAGGUCAUUGCCGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Clostridium acetobutylicum 5S rRNA
  2. Clostridium acetobutylicum ATCC 824 5S ribosomal RNA
  3. Clostridium acetobutylicum DSM 1731 5Sf ribosomal RNA
  4. Clostridium acetobutylicum EA 2018 5S ribosomal RNA
 2D structure