Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-214 precursor URS0000160683_9606

Automated summary: This pre miRNA sequence is 110 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (GeneCards, RefSeq, miRBase, Ensembl, ENA, MalaCards, HGNC, Rfam). Described in 59 papers. Matches 1 Rfam family (mir-214, RF00660). Homo sapiens (human) microRNA hsa-mir-214 precursor sequence is a product of 214, mir-214, hsa-mir-214 precursor, ENSG00000283844.1, MIR214, mir-214 precurso, mir-214 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 192 other species

    1. Aotus nancymaae (Ma's night monkey) miRNA MIR214 (ENSANAG00000009637.1)
    2. Ateles geoffroyi microRNA age-mir-214 precursor
    3. Callithrix jacchus cja-mir-3120 (ENSCJAG00000030390.3)
    4. Carlito syrichta miRNA MIR214 (ENSTSYG00000022233.2)
    5. Castor canadensis microRNA 214 (ENSCCNG00000016370.1)
    6. Cavia porcellus microRNA 214 (ENSCPOG00000016605.3)
    7. Cercocebus atys (Sooty mangabey) miRNA MIR214 (ENSCATG00000022725.1)
    8. Chlorocebus sabaeus miRNA MIR214 (ENSCSAG00000026679.1)
    9. Colobus angolensis palliatus miRNA (ENSCANG00000019218.1)
    10. Cricetulus griseus miRNA (ENSCGRG00000021251.1, ENSCGRG00001001342.1, ENSCGRG00015011417.1)
    11. Fukomys damarensis miRNA (ENSFDAG00000004387.1)
    12. Gorilla gorilla gorilla ggo-mir-214 (ENSGGOG00000032556.2)
    13. Gorilla gorilla microRNA ggo-mir-214 precursor
    14. Heterocephalus glaber microRNA 214 (ENSHGLG00000022096.1, ENSHGLG00100022752.1)
    15. Macaca fascicularis microRNA 214 (ENSMFAG00000020383.2)
    16. Macaca mulatta microRNA mml-mir-214 precursor
    17. Macaca nemestrina microRNA mne-mir-214 precursor
    18. Mandrillus leucophaeus microRNA 214 (ENSMLEG00000022217.1)
    19. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000016369.1)
    20. Mesocricetus auratus miRNA (ENSMAUG00000005633.1)
    21. Microcebus murinus (gray mouse lemur) microRNA 214 (ENSMICG00000018168.3)
    22. Microtus ochrogaster (vole) microRNA 214 (ENSMOCG00000007654.1)
    23. Mus musculus microRNA mmu-mir-214 precursor
    24. Mus pahari (Shrew mouse) microRNA 214 (MGP_PahariEiJ_G0007514.1)
    25. Mus spicilegus miRNA (ENSMSIG00000021358.1)
    26. Mus spretus (algerian mouse) microRNA 214 (MGP_SPRETEiJ_G0007323.1)
    27. Nannospalax galili (Upper Galilee mountains blind mole rat) microRNA 214 (ENSNGAG00000006294.1)
    28. Neotoma lepida microRNA mir-214
    29. Nomascus leucogenys miRNA (ENSNLEG00000026352.2)
    30. Oryctolagus cuniculus microRNA 214 (ENSOCUG00000018870.1)
    31. Otolemur garnettii miRNA (ENSOGAG00000019464.1)
    32. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-214 precursor
    33. Pan troglodytes (chimpanzee) microRNA ptr-mir-214 precursor
    34. Papio anubis miRNA (ENSPANG00000003066.3)
    35. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 214 (ENSPEMG00000005711.2)
    36. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 214 (ENSPTEG00000015318.1)
    37. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000022170.2)
    38. Pongo pygmaeus microRNA ppy-mir-214 precursor
    39. Prolemur simus microRNA 214 (ENSPSMG00000008026.1)
    40. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000002689.1)
    41. Rattus norvegicus microRNA 3120 (ENSRNOG00000035513.3)
    42. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000017276.1, ENSRBIG00000017301.1)
    43. Rhinopithecus roxellana microRNA 214 (ENSRROG00000012913.1)
    44. Saguinus labiatus microRNA sla-mir-214 precursor
    45. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000003247.1)
    46. Theropithecus gelada microRNA 214 (ENSTGEG00000004931.1)
    47. Tupaia belangeri (northern tree shrew) microRNA 214 (ENSTBEG00000017903.1)
    Publications New