Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-95 precursor URS000015F70F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR95: MIR95 is a microRNA that is highly expressed in prostate and lung cancers and has oncogenic function [PMC5302951]. In patients with primary myelofibrosis, there is a decrease in the expression of MIR95 [PMC6183594]. MIR95 has also been found to be expressed more in tolerant recipients compared to non-tolerant recipients, and it is positively correlated with activated Treg markers [PMC7412931]. It has been suggested that a disruption of the binding site of MIR95 may affect its expression and modulatory effect in myogenic cells, indicating its potential role as a disease modifier [PMC6969370]. In pancreatic intraepithelial neoplasms and pancreatic adenocarcinomas, there is an upregulation of MIR95 compared to normal pancreatic tissue [PMC3849454]. Knockdown of MIR95 has been shown to speed up apoptosis induced by irradiation [PMC6525830]. The genomic organization and sequence conservation of MIR95 have been investigated, with experimental validation confirming its relevance as a pool of miRNAs [PMC3874173]. Overall, these findings highlight the importance of MIR95 in various biological processes and disease conditions [PMC5302951, PMC6183594, PMC7412931, PMC6969370, PMC3849454, PMC6525830, PMC3874173].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACACAGUGGGCACUCAAUAAAUGUCUGUUGAAUUGAAAUGCGUUACAUUCAACGGGUAUUUAUUGAGCACCCACUCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

Publications