Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-95 precursor URS000015F70F_9606

  • 81 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 21 species
  • transcript

Automated summary: This precursor RNA sequence is 81 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl/GENCODE, ENA, RefSeq, GeneCards, Ensembl, miRBase, HGNC, MalaCards). Described in 29 papers. Homo sapiens (human) microRNA hsa-mir-95 precursor sequence is a product of 95-precursor-4, miR-95-precursor-4, hsa-mir-95 precursor, mir-95, mir-95 precurso, MIR95, mir-95 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AACACAGUGGGCACUCAAUAAAUGUCUGUUGAAUUGAAAUGCGUUACAUUCAACGGGUAUUUAUUGAGCACCCACUCUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Aotus nancymaae miRNA
    2. Callithrix jacchus cja-mir-95
    3. Cercocebus atys (Sooty mangabey) miRNA
    4. Chlorocebus sabaeus (African green monkey) miRNA
    5. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-95
    6. Gorilla gorilla microRNA ggo-mir-95 precursor
    7. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-95 precursor
    8. Macaca fascicularis miRNA
    9. Macaca mulatta microRNA mml-mir-95 precursor
    10. Macaca nemestrina miRNA
    11. Mandrillus leucophaeus (Drill) miRNA
    12. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    13. Pan troglodytes (chimpanzee) microRNA ptr-mir-95 precursor
    14. Papio anubis (Olive baboon) miRNA
    15. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 95
    16. Pongo abelii microRNA 95
    17. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-95 precursor
    18. Rhinopithecus bieti miRNA
    19. Rhinopithecus roxellana microRNA 95
    20. Saguinus labiatus (red-chested mustached tamarin) microRNA sla-mir-95 precursor
    21. Theropithecus gelada microRNA 95