Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pectobacterium carotovorum 5S ribosomal RNA secondary structure diagram

Pectobacterium carotovorum 5S ribosomal RNA URS000015F4B4_554

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCGGCGAUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUUUCCCCAUGUGAGAGUAGGGAACUGCCAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Pectobacterium parmentieri WPP163 5S ribosomal RNA
  2. Pectobacterium parmentieri Pectobacterium sp. SCC3193 5S rRNA
  3. Pectobacterium versatile 5S ribosomal RNA
  4. Pectobacterium wasabiae 5S rRNA
2D structure