Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cyanothece sp. PCC 8802 5S rRNA secondary structure diagram

Cyanothece sp. PCC 8802 5S rRNA URS000015D565_395962

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUGUCUCUAGCGUCGUGGCCCCACUCCGACCCCAUCCCGAACUCGGCAGUGAAACGCGAUAGCGGCAACGAUACUCGUGGGGUAGCUCACUGGGACAAUAGCUCGAUGCCAGGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Rippkaea orientalis PCC 8801 Cyanothece sp. PCC 8801 5S rRNA
2D structure