Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-487b-3p URS000015B295_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCGUACAGGGUCAUCCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Bos taurus (cattle) bta-miR-487b
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-487b
  3. Canis lupus familiaris cfa-miR-487b
  4. Capra hircus (goat) chi-miR-487b-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-487b-3p
  6. Cervus elaphus (red deer) cel-miR-487b
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487b-3p
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P17_3p (mature (guide))
  9. Equus caballus eca-miR-487b
  10. Homo sapiens hsa-miR-487b-3p
  11. Macaca mulatta (Rhesus monkey) mml-miR-487b-3p
  12. Mus musculus mmu-miR-487b-3p
  13. Oryctolagus cuniculus (rabbit) ocu-miR-487b-3p
  14. Pan troglodytes ptr-miR-487b
  15. Pongo pygmaeus ppy-miR-487b
  16. Pteropus alecto (black flying fox) pal-miR-487b-3p
  17. Rattus norvegicus rno-miR-487b-3p
Publications