Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-487b URS000015B295_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-487b: bta-mir-487b is a microRNA that has been found to be correlated with methane metabolism and several other pathways in the rumen [PMC9378797]. It has the highest number of correlations with different genera and is associated with sugar metabolism, transcription factors, and transporters [PMC9378797]. However, its relationship with bacteria is not well understood yet [PMC9378797]. Interestingly, bta-mir-487b is negatively correlated with Gram-positive strains despite being positively correlated with the peptidoglycan biosynthesis pathway [PMC9378797]. It also shows a strong correlation with a high number of taxa [PMC9378797]. In terms of expression levels, bta-mir-487b is differentially expressed in peak and late lactation in bovine tissue, being higher in late lactation compared to peak lactation [PMC3498112]. Additionally, bta-mir-487b is highly expressed in the fetal stage and other differentiated tissues but not found in bovine calf or adult muscles [PMC3563516]. References: [PMC9378797] - Morgavi DP et al. (2021) Rumen microbiome-host interactions: Insights into the role of microRNAs. Front Microbiol. 12: 637637. doi: 10.3389/fmicb.2021.637637. [PMC3498112] - Li R et al. (2012) Comparative microRNAome analysis of the mammary gland tissues from two breeds of cattle after removal of suckling stress using deep sequencing. PLoS One 7(9): e44587. [PMC3563516] - Li R et al. (2013) Comparative analysis of muscle miRNAs between prenatal development and adulthood reveals miR-483 as a candidate regulating muscle differentiation via IGF-1 signaling pathway. PLoS One 8(5): e62787.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCGUACAGGGUCAUCCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Callithrix jacchus cja-miR-487b
  2. Canis lupus familiaris cfa-miR-487b
  3. Capra hircus (goat) chi-miR-487b-3p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-487b-3p
  5. Cervus elaphus (red deer) cel-miR-487b
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487b-3p
  7. Echinops telfairi Ete-Mir-154-P17_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-487b
  9. Homo sapiens hsa-miR-487b-3p
  10. Macaca mulatta mml-miR-487b-3p
  11. Mus musculus (house mouse) mmu-miR-487b-3p
  12. Oryctolagus cuniculus ocu-miR-487b-3p
  13. Ovis aries (sheep) oar-miR-487b-3p
  14. Pan troglodytes (chimpanzee) ptr-miR-487b
  15. Pongo pygmaeus ppy-miR-487b
  16. Pteropus alecto pal-miR-487b-3p
  17. Rattus norvegicus (Norway rat) rno-miR-487b-3p
Publications