Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-487b-3p URS000015B295_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-487b: Hsa-mir-487b is a microRNA (miRNA) that has been studied in various contexts [PMC4784328]. It has been found to have a fold change close to significance in relation to relapse versus control in certain conditions [PMC4784328]. In the context of glioblastoma multiforme (GBM) and Alzheimer's disease (AD), hsa-mir-487b is one of the miRNAs that show differential expression [PMC9965735]. It has also been identified as one of the fragil miRNAs and found to have a significant hazard ratio [PMC3002314]. However, it is worth noting that hsa-mir-487b has not been validated through biological experiments [PMC8082881]. In the context of distinguishing different types of lymphoma, hsa-mir-487b is one of the miRNAs used in discriminant functions [PMC4335255]. Hsa-mir-487b has also been found to regulate the expression of target genes involved in various biological processes [PMC9777571]. It has been analyzed alongside other miRNAs in different studies [PMC9270956, PMC6682788, PMC6254589, PMC5223123]. Hsa-mir-487b is more widely expressed in endothelial and muscle cells, including cancer cells [PMC5223123]. In relation to AD, hsa-mir-487b interacts with the AD pathway and targets different genes involved in this disease [PMC6682788]. Additionally, hsa-mir-487b has been identified as one of the potential predictors for patient survival and as having a role in cancer stem cells function [PMC5601660, PMC3629228, PMC3241557].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCGUACAGGGUCAUCCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-487b
  2. Callithrix jacchus cja-miR-487b
  3. Canis lupus familiaris cfa-miR-487b
  4. Capra hircus (goat) chi-miR-487b-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-487b-3p
  6. Cervus elaphus (red deer) cel-miR-487b
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487b-3p
  8. Echinops telfairi Ete-Mir-154-P17_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-487b
  10. Macaca mulatta mml-miR-487b-3p
  11. Mus musculus (house mouse) mmu-miR-487b-3p
  12. Oryctolagus cuniculus ocu-miR-487b-3p
  13. Ovis aries (sheep) oar-miR-487b-3p
  14. Pan troglodytes (chimpanzee) ptr-miR-487b
  15. Pongo pygmaeus ppy-miR-487b
  16. Pteropus alecto pal-miR-487b-3p
  17. Rattus norvegicus (Norway rat) rno-miR-487b-3p
Publications