Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-487b URS000015B295_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCGUACAGGGUCAUCCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-487b
  2. Callithrix jacchus cja-miR-487b
  3. Canis lupus familiaris cfa-miR-487b
  4. Capra hircus (goat) chi-miR-487b-3p
  5. Cavia porcellus (domestic guinea pig) cpo-miR-487b-3p
  6. Cervus elaphus (red deer) cel-miR-487b
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487b-3p
  8. Echinops telfairi Ete-Mir-154-P17_3p (mature (guide))
  9. Equus caballus (horse) eca-miR-487b
  10. Homo sapiens hsa-miR-487b-3p
  11. Macaca mulatta mml-miR-487b-3p
  12. Mus musculus (house mouse) mmu-miR-487b-3p
  13. Oryctolagus cuniculus ocu-miR-487b-3p
  14. Ovis aries (sheep) oar-miR-487b-3p
  15. Pongo pygmaeus ppy-miR-487b
  16. Pteropus alecto pal-miR-487b-3p
  17. Rattus norvegicus (Norway rat) rno-miR-487b-3p
Publications