Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Anoxybacillus sp. EFIL tRNA-Gly secondary structure diagram

Anoxybacillus sp. EFIL tRNA-Gly URS000015A751_2508869

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGAAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAGUCCCGUCUUCCGCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 128 other species

  1. Anoxybacteroides amylolyticum tRNA-Gly
  2. Anoxybacillus ayderensis tRNA-Gly
  3. [Anoxybacillus] calidus tRNA-Gly
  4. Anoxybacillus eryuanensis tRNA-Gly
  5. Anoxybacillus flavithermus AK1 tRNA-Gly
  6. Anoxybacillus flavithermus NBRC 109594 tRNA-Gly
  7. Anoxybacillus flavithermus TNO-09.006 tRNA-Gly
  8. Anoxybacillus flavithermus tRNA-Gly
  9. Anoxybacillus flavithermus WK1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  10. Anoxybacteroides rupiense Anoxybacillus geothermalis tRNA-Gly
  11. Anoxybacillus gonensis tRNA-Gly
  12. Anoxybacillus ayderensis G10 tRNA-Gly
  13. Anoxybacillus ayderensis tRNA-Gly
  14. Anoxybacillus kestanbolensis tRNA-Gly
  15. Anoxybacillus kestanbolensis tRNA-Gly
  16. Anoxybacillus mongoliensis tRNA-Gly
  17. Anoxybacillus sp. B2M1 tRNA-Gly
  18. Anoxybacillus sp. B7M1 tRNA-Gly
  19. Anoxybacillus sp. BCO1 tRNA-Gly
  20. Anoxybacillus sp. CHMUD tRNA-Gly
  21. Anoxybacillus dikiliensis Anoxybacillus sp. D401a tRNA-Gly
  22. Anoxybacillus sp. FSL W8-0104 tRNA-Gly
  23. Anoxybacillus sp. FSL W8-0382 tRNA-Gly
  24. Anoxybacillus sp. FSL W8-0703 tRNA-Gly
  25. Anoxybacillus sp. FSL W8-1294 tRNA-Gly
  26. Anoxybacillus sp. J5B_2022 tRNA-Gly
  27. Anoxybacillus sp. KU2-6(11) (11) tRNA-Gly
  28. Anoxybacillus sp. LAT_11 tRNA-Gly
  29. Anoxybacillus sp. LAT_26 tRNA-Gly
  30. Anoxybacillus sp. LAT27 tRNA-Gly
  31. Anoxybacillus sp. LAT_31 tRNA-Gly
  32. Anoxybacillus sp. LAT_33 tRNA-Gly
  33. Anoxybacillus sp. LAT_35 tRNA-Gly
  34. Anoxybacillus sp. LAT_38 tRNA-Gly
  35. Anoxybacillus sp. P3H1B tRNA-Gly
  36. Anoxybacillus sp. PDR2 tRNA-Gly
  37. Anoxybacillus sp. ST4 tRNA-Gly
  38. Anoxybacillus sp. ST70 tRNA-Gly
  39. Anoxybacillus sp. tRNA-Gly
  40. Anoxybacillus sp. UARK-01 tRNA-Gly
  41. Anoxybacillus suryakundensis tRNA_Gly_GCC
  42. Anoxybacillus tengchongensis tRNA-Gly
  43. Anoxybacillus thermarum tRNA-Gly
  44. Anoxybacteroides rupiense tRNA-Gly
  45. Anoxybacteroides voinovskiense tRNA-Gly
  46. Caryophanales bacterium (coal metagenome) tRNA-Gly
  47. Bacilli bacterium tRNA-Gly
  48. Bacillota bacterium tRNA-Gly
  49. Bacillus methanolicus MGA3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1 1 to 3)
  50. Bacillus methanolicus PB1 tRNA-Gly
  51. Bacillus methanolicus tRNA-Gly
  52. Bacillus smithii 7_3_47FAA tRNA-Gly
  53. Bacillus smithii tRNA-Gly
  54. Bacillus sp. FSL W8-0102 tRNA-Gly
  55. Bacillus sp. FSL W8-0116 tRNA-Gly
  56. Bacillus sp. FSL W8-0223 tRNA-Gly
  57. Bacillus sp. FSL W8-1127 tRNA-Gly
  58. Bacillus sp. PS196 tRNA-Gly
  59. Bacillus subtilis subsp. subtilis tRNA-Gly
  60. Bacillus subtilis tRNA-Gly
  61. Neobacillus thermocopriae tRNA-Gly
  62. Bhargavaea massiliensis tRNA-Gly
  63. Caldibacillus thermoamylovorans tRNA-Gly
  64. Camelliibacillus cellulosilyticus tRNA-Gly
  65. [Flavobacterium] thermophilum tRNA-Gly(gcc)
  66. Parageobacillus galactosidasius tRNA-Gly
  67. Geobacillus genomosp. 3 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  68. Geobacillus icigianus tRNA-Gly
  69. Geobacillus jurassicus tRNA-Gly
  70. Geobacillus lituanicus tRNA-Gly
  71. Geobacillus sp. 12AMOR1 tRNA-Gly
  72. Geobacillus sp. 44B tRNA-Gly
  73. Geobacillus sp. 44C tRNA-Gly
  74. Geobacillus sp. 46C-IIa tRNA-Gly
  75. Geobacillus sp. 47C-IIb tRNA-Gly
  76. Geobacillus sp. A8 tRNA-Gly
  77. Geobacillus sp. BCO2 tRNA-Gly
  78. Geobacillus sp. BK01 tRNA-Gly
  79. Geobacillus sp. BMUD tRNA-Gly
  80. Geobacillus sp. C56-T2 tRNA-Gly
  81. Geobacillus sp. DSP4a tRNA-Gly
  82. Geobacillus sp. FSL K6-0789 tRNA-Gly
  83. Geobacillus sp. FSL K6-3411 tRNA-Gly
  84. Geobacillus sp. FSL W8-0026 tRNA-Gly
  85. Geobacillus sp. FSL W8-0032 tRNA-Gly
  86. Geobacillus sp. FSL W8-0466 tRNA-Gly
  87. Geobacillus sp. FSL W8-1251 tRNA-Gly
  88. Geobacillus sp. LC300 tRNA-Gly
  89. Geobacillus sp. MMMUD3 tRNA-Gly
  90. Geobacillus sp. MR tRNA-Gly
  91. Geobacillus sp. NFOSA3 tRNA-Gly
  92. Geobacillus sp. Sah69 tRNA-Gly
  93. Parageobacillus sp. SY1 tRNA-Gly
  94. Geobacillus sp. T6 tRNA-Gly
  95. Geobacillus sp. WCH70 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  96. Geobacillus sp. WSUCF-018B tRNA-Gly
  97. Geobacillus sp. Y4.1MC1 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  98. Geobacillus sp. YF-1 tRNA-Gly
  99. Geobacillus stearothermophilus ATCC 12980 tRNA-Gly
  100. Geobacillus stearothermophilus ATCC 7953 tRNA-Gly
  101. Geobacillus stearothermophilus tRNA-Gly(gcc)
  102. Geobacillus subterraneus tRNA-Gly
  103. Geobacillus thermocatenulatus tRNA-Gly
  104. Geobacillus thermodenitrificans NG80-2 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1)
  105. Geobacillus thermodenitrificans tRNA-Gly
  106. Geobacillus uzenensis tRNA-Gly
  107. Parageobacillus caldoxylosilyticus NBRC 107762 tRNA-Gly
  108. Parageobacillus caldoxylosilyticus tRNA-Gly
  109. Parageobacillus genomosp. 1 tRNA-Gly
  110. Parageobacillus sp. G301 tRNA-Gly
  111. Parageobacillus sp. KH3-4 tRNA-Gly
  112. Parageobacillus sp. VR-IP tRNA-Gly
  113. Parageobacillus thermoglucosidasius C56-YS93 tRNA-Gly (GCC) (tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-2)
  114. Parageobacillus thermoglucosidasius NBRC 107763 tRNA-Gly
  115. Parageobacillus thermoglucosidasius TNO-09.020 tRNA-Gly
  116. Parageobacillus thermoglucosidasius tRNA-Gly
  117. Parageobacillus toebii tRNA-Gly
  118. Saccharococcus sp. 23_S122 tRNA-Gly
  119. Saccharococcus thermophilus tRNA-Gly
  120. soil metagenome tRNA
  121. Thermaerobacillus caldiproteolyticus tRNA-Gly
  122. Thermolongibacillus altinsuensis tRNA-Gly
  123. Geobacillus kaustophilus tRNA-glycine from Geobacillus kaustophilus (PDB 4MGN, chain D)
  124. uncultured Anoxybacillus sp. tRNA
  125. Ureibacillus sp. FSL K6-3587 tRNA-Gly
  126. Ureibacillus sp. FSL K6-8385 tRNA-Gly
  127. Ureibacillus sp. FSL W7-1570 tRNA-Gly
  128. Ureibacillus suwonensis tRNA-Gly
  129. Ureibacillus terrenus tRNA-Gly
  130. Ureibacillus thermophilus tRNA-Gly
Relationships

Molecular Relationships

2D structure

Loading 2D structure...