v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 355 (LINC00355) URS0000158102_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00355: LINC00355 is a long non-coding RNA (lncRNA) that has been implicated in various types of cancer, including gastric cancer, glioma, bladder cancer, and colon cancer [PMC7544820] [PMC8486503] [PMC7769380] [PMC7349410] [PMC7689553]. In gastric cancer, LINC00355 has been shown to promote cell proliferation and invasion by upregulating the transcription of RAD18 and UBE3C, which in turn facilitate the ubiquitination and degradation of P53 [PMC7544820]. In glioma patients, LINC00355 levels were detected using RT-PCR, suggesting its potential role in glioma tumorigenesis [PMC8486503]. RNA pull-down assays revealed that LIN28A could be enriched by biotinylated sense LINC00355 in HCT-116 cells [PMC7769380]. Additionally, LINC00355 has been found to be upregulated in bladder cancer samples and contributes to apoptosis inhibition, cell proliferation, and migration [PMC7349410]. The subcellular location of LINC00355 was determined using RNA-FISH techniques [PMC7584152]. In colon cancer cells, blocking the expression of LINC00355 arrested cell proliferation, invasion and migration while promoting apoptosis [PMC7689553]. Furthermore, a study suggested that lncRNAs from CAF-derived exosomes may play a role in cancer progression and immune evasion in various types of cancers including bladder cancer (LINC00355) and esophageal squamous cell carcinoma (POU3F3) among others. The study also proposed that MEG3 released from CAF-derived exosomes may be a crucial regulator of SCLC tumorigenesis and chemoresistance based on previous findings.

Targeting miRNAs 20 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACAGAGCUGGUGGGAGCUGGGAAUAGGUGAAAACCCUGCCUCCUUGUGAGUUGGCAGGACGGGAGCCUCCUGUUCCCUGGCUGCUGUUGUGGCCACCGAGCCGCAGCCCUGGAGCCAGGCAUCCCUGUGCUUGGGGAUCAGAGCGAGCAGGAGCAGAUCCUCUCCCUUCUGGGUGCAGCUGCAGCUGCCCAGCCAUGGCUGUGGUCCCGGAAGUCUCUGUGCUCUUGGGAGCUGGGAGGGCCCUCUGCCUCCUGCCCCUUACGCACUCCAGAGUCUCCUCUCUGUUGAGAGCUAAGCAGACAUCAGGACUACCAGCUGCAGAGAGGAGCUACCCACUGUGGGCUUCGUCUCUGCUGAGAGCUGAACACUCACUGGGACGCCCUGCCUAUGGAAACCAGCUGUUCACUCUGGGUCUCCUCUGAGCUGUUCUGUCGCUCAGUAAAGGUCUUCUUCUGCUUACUCGCCCUCCAUUUGUCUGCCUUACCUCAUUCAUCCUGGACACAGGACAAGAACUUGGGACUUGCCGGUAUGGUGGAGCUAAAAUAGCUGUAACACAAACAGGAUUGAAACAUGCCCCUUGCUCGCCACAUUGUGGAUGACAAGAGGGAGGGAAGAAAGGAGAGAAGAUCUGCGACCCUUCGGCAAACCCAGACUUAGGAGAUCGGAGAGCCAAGACUGUGACACCCUUUCUGGGGCUCUGUGGUUCCUGGCGUCUCCAAGCUUCUGGGCACCUCGGCUUUCCCCGGUGCCAGUCGUGGAAGCUGCUUGUGGCCUCCAUUUGCUGUUUGGGAAACUCUCUACGCUAUGAAUGUUAGCUGGCAGCAAACACUGCCUCCCACUACAGGGGCACACAGUGUUGGUGCCUGCUUUUCCACCCUCCACUUCCAACAGGAAGCAAGCACAGGACCCAAGCAUUGCAGACAGUUGUAUCACGCCAAUGUGCAUUCGGAGCCACUGACAGAGUCUUGCUUUGUCACCCAGGCUGGAGUACAGUGGCGUGAUCACAGCUUACUGAAACGUCUGCGUCUCAGGUUCAAGCGAUUUUUCUGCCUCAGCCUCUGGUGUAGCUGGAAUUACAGUGUUAGCAGUCACUGAUGCUCAAACAUGAGAAGACUGGGACAUCCAUCAGAUAAGAAACGCUGCCCAAAGUGUUAGACUAAUAAGUGACAGGGUUGGACAAUGAACCCAACCACUCAACCUUCCGGAAAAGUGCUGGAGAGGAUGUGGAGAAAUAGGAACACUUUUACACUGUUGGUGGGACUGUAAACUAGUUCAACCAUUGUGGAAGUCAGUGUGGCGAUUCCUCAGAGAUGUAGAACUAGAAAUACCAUUUGACCCAGCCAUCCCAUUACUGGGUAUGUACCCAAAGGAUUAUAAAUCAUGCUGCUAUAAAGACACAUACACACGUAUGUUUAUUGUGGCACUAUUCACAACAGCAAAGACAUGGAAUCAACCCAAAUGUCCAACAACGAUAGACUGGAUUAAGAAAAUGUGGCACAUAUACACCAUGGAAUACUAUGCAGCCAUAAAAAAUGAUGAGUUCAUGUCCUUUGUAGGGACAUGGAUGAAGCUAGGUGAAGCAAUUCCUUUCCUGAGGAAAAUAGAACUCACUCUGCUCUGGCUUGUAUGAGGAGGAAUAGGAUAUAAGCAGUUGAGGAAGAACGGUCCAUGAGUUGCCAUCCUUCCCUCUUCCUGCCUGCCAGAAGAGGUAGAGCCCACUGAAGAAGGAGCAGAAUAAGGAAUGGAAACCUUAGUUACAAGUCCAAGAAAUUCUACCCACUCUACUAUUUUUUUAUGUGUAACUUGAUUUAUAGUUUUUACUUUGAAAGAAUGUAACUAUUGUACAUGUUUCAUAAAGUAUCAAUAGCUGAAUAGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications