Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00001578E7_559292

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCAAACCUUUUUGUCAGGGUGCUUCUCUAUCCGUUUUAGGAUAAACUUAUCUACAGAAGUGUCUGUUACUGUUUUGGAAGAGUAAUACUGUUCGCUUAUCCAUAUUUCCCCGUUCUGGGGAAGCCUCAUGGGUAAAUUAGAAGGACAACCUUUGUUUUAAAGGUAUACCUUCGCUUUUUAGAACAGCGAGGAUCUUAUGAGUUGAGCUUUUGUUAUUUGAGACUUUAUCUCGGGCUCCAUACAAUAUGUUCGUAGUAAAGAUCCUCACAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Marmota marmota marmota snoRNA (ENSMMMG00000008275.1)
  2. Saccharomyces cerevisiae Small nucleolar RNA snR191
  3. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR191
  4. Saccharomyces cerevisiae YJM1078 SNR191
  5. Saccharomyces cerevisiae YJM1242 SNR191
  6. Saccharomyces cerevisiae YJM1252 SNR191
  7. Saccharomyces cerevisiae YJM1304 SNR191
  8. Saccharomyces cerevisiae YJM1307 SNR191
  9. Saccharomyces cerevisiae YJM1332 SNR191
  10. Saccharomyces cerevisiae YJM1336 SNR191
  11. Saccharomyces cerevisiae YJM1356 SNR191
  12. Saccharomyces cerevisiae YJM1383 SNR191
  13. Saccharomyces cerevisiae YJM1417 SNR191
  14. Saccharomyces cerevisiae YJM1433 SNR191
  15. Saccharomyces cerevisiae YJM1477 SNR191
  16. Saccharomyces cerevisiae YJM189 SNR191
  17. Saccharomyces cerevisiae YJM326 SNR191
  18. Saccharomyces cerevisiae YJM450 SNR191
  19. Saccharomyces cerevisiae YJM555 SNR191
  20. Saccharomyces cerevisiae YJM682 SNR191
  21. Saccharomyces cerevisiae YJM683 SNR191
  22. Saccharomyces cerevisiae YJM693 SNR191
  23. Saccharomyces cerevisiae YJM969 SNR191
  24. Saccharomyces cerevisiae YJM972 SNR191
  25. Saccharomyces cerevisiae YJM975 SNR191
  26. Saccharomyces cerevisiae YJM978 SNR191
  27. Saccharomyces cerevisiae YJM981 SNR191
  28. Saccharomyces cerevisiae YJM984 SNR191
  29. Saccharomyces cerevisiae YJM987 SNR191
  30. Saccharomyces cerevisiae YJM990 SNR191
  31. Saccharomyces cerevisiae YJM993 SNR191
  32. Saccharomyces cerevisiae YJM996 SNR191
2D structure Publications