Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS00001578E7_559292

Automated summary: This snoRNA sequence is 274 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (SGD, RefSeq, Rfam, ENA, IntAct). Described in 24 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR191, RF01263). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR191 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 1

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-11710827 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACCAAACCUUUUUGUCAGGGUGCUUCUCUAUCCGUUUUAGGAUAAACUUAUCUACAGAAGUGUCUGUUACUGUUUUGGAAGAGUAAUACUGUUCGCUUAUCCAUAUUUCCCCGUUCUGGGGAAGCCUCAUGGGUAAAUUAGAAGGACAACCUUUGUUUUAAAGGUAUACCUUCGCUUUUUAGAACAGCGAGGAUCUUAUGAGUUGAGCUUUUGUUAUUUGAGACUUUAUCUCGGGCUCCAUACAAUAUGUUCGUAGUAAAGAUCCUCACAAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Marmota marmota marmota (Alpine marmot) snoRNA (ENSMMMG00000008275.1)
    2. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR191
    3. Saccharomyces cerevisiae VL3 Small nucleolar RNA snR191
    4. Saccharomyces cerevisiae YJM1078 SNR191
    5. Saccharomyces cerevisiae YJM1242 SNR191
    6. Saccharomyces cerevisiae YJM1252 SNR191
    7. Saccharomyces cerevisiae YJM1304 SNR191
    8. Saccharomyces cerevisiae YJM1307 SNR191
    9. Saccharomyces cerevisiae YJM1332 SNR191
    10. Saccharomyces cerevisiae YJM1336 SNR191
    11. Saccharomyces cerevisiae YJM1356 SNR191
    12. Saccharomyces cerevisiae YJM1383 SNR191
    13. Saccharomyces cerevisiae YJM1417 SNR191
    14. Saccharomyces cerevisiae YJM1433 SNR191
    15. Saccharomyces cerevisiae YJM1477 SNR191
    16. Saccharomyces cerevisiae YJM189 SNR191
    17. Saccharomyces cerevisiae YJM326 SNR191
    18. Saccharomyces cerevisiae YJM450 SNR191
    19. Saccharomyces cerevisiae YJM555 SNR191
    20. Saccharomyces cerevisiae YJM682 SNR191
    21. Saccharomyces cerevisiae YJM683 SNR191
    22. Saccharomyces cerevisiae YJM693 SNR191
    23. Saccharomyces cerevisiae YJM969 SNR191
    24. Saccharomyces cerevisiae YJM972 SNR191
    25. Saccharomyces cerevisiae YJM975 SNR191
    26. Saccharomyces cerevisiae YJM978 SNR191
    27. Saccharomyces cerevisiae YJM981 SNR191
    28. Saccharomyces cerevisiae YJM984 SNR191
    29. Saccharomyces cerevisiae YJM987 SNR191
    30. Saccharomyces cerevisiae YJM990 SNR191
    31. Saccharomyces cerevisiae YJM993 SNR191
    32. Saccharomyces cerevisiae YJM996 SNR191
    2D structure New