Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Streptomyces filamentosus NRRL 11379 5S ribosomal RNA secondary structure diagram

Streptomyces filamentosus NRRL 11379 5S ribosomal RNA URS0000156104_457430

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGUGGUCAUUGCGUUAGGGAAACGCCCGGUUACAUUCCGAACCCGGAAGCUAAGCCUUUCAGCGCCGAUGGUACUGCAGGGGGGACCCUGUGGGAGAGUAGGACGCCGCCGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Streptomyces microflavus 5S rRNA
  2. Streptomyces griseus 5S ribosomal RNA
  3. Streptomyces hygroscopicus 5S ribosomal RNA
  4. Streptomyces lydicamycinicus 5S ribosomal RNA
  5. Streptomyces lydicus 5S ribosomal RNA
  6. Streptomyces malaysiensis 5S ribosomal RNA
  7. Streptomyces microflavus DSM 40593 5S ribosomal RNA
  8. Streptomyces pristinaespiralis 5S ribosomal RNA
  9. Streptomyces pristinaespiralis ATCC 25486 5S ribosomal RNA
  10. Streptomyces sp. CA-256286 5S ribosomal RNA
  11. Streptomyces sp. CBMAI 2042 5S ribosomal RNA
  12. Streptomyces sp. IB2014 011-1 5S ribosomal RNA
  13. Streptomyces sp. KY70 ribosomal RNA 5s_rRNA
  14. Streptomyces sp. KY75 ribosomal RNA 5s_rRNA
  15. Streptomyces sp. M56 5S ribosomal RNA
  16. Streptomyces sp. NP10 5S ribosomal RNA
  17. Streptomyces sp. PTY087I2 5S ribosomal RNA
  18. Streptomyces sp. S4.7 5S ribosomal RNA
  19. Streptomyces sp. W007 5S ribosomal RNA
2D structure