Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bacillus cereus Q1 5S ribosomal RNA secondary structure diagram

Bacillus cereus Q1 5S ribosomal RNA URS00001540FC_361100

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGUGAUGAUGGCAGAGAGGUCACACCCGUUCCCAUACCGAACACGGAAGUUAAGCUCUCUAGCGCCGAUGGUAGUUGGGACCUUGUCCCUGUGAGAGUAGGACGUCGCCAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Bacillus cereus 5S rRNA
  2. Bacillus cereus ATCC 14579 5S ribosomal RNA
  3. Bacillus thuringiensis serovar israelensis ATCC 35646 5S RNA
2D structure