v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
tRNA from Nicotiana tabacum (PDB 8B2L, chain W2) secondary structure diagram

tRNA from Nicotiana tabacum (PDB 8B2L, chain W2) URS00001504D0_4097

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGGGGAUAGCUCAGUUGGGAGAGCGUCAGACUGAAGAUCUGAAGGUCGCGUGUUCGAUCCACGCUCACCGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Hordeum vulgare tdbR00000087
  2. Triticum aestivum tdbR00000088
  3. Brassica napus tdbR00000089
  4. Lathyrus oleraceus tdbR00000091
  5. Arabidopsis thaliana Transfer RNA Phe from Arabidopsis thaliana (PDB 9H3G, chain W2)
  6. Triticum sp. tRNA-Phe
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications