v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
ASPARTYL-TRNA from Escherichia coli (PDB 1EFW, chain D) secondary structure diagram

ASPARTYL-TRNA from Escherichia coli (PDB 1EFW, chain D) URS0000150212_562

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCCUGUCACGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Enterobacter cloacae complex sp. I7 tRNA-Asp
  2. Klebsiella ornithinolytica tRNA-Asp
  3. Klebsiella oxytoca tRNA-Asp(gtc)
  4. Klebsiella pneumoniae subsp. pneumoniae KPNIH12 tRNA-Asp
  5. Klebsiella pneumoniae tRNA-Asp
  6. Shigella flexneri tRNA-Asp
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications