Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Dinoponera quadriceps (south american ant) tRNA secondary structure diagram

Dinoponera quadriceps (south american ant) tRNA URS000014ECD8_609295

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCCCUUUGGCGCAGAGGAUAGCGCGUUGGACUUCUAAUCCAAAGGUCGCGGGUUCGAUCCCCGCAAGGGAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 96 other species

  1. Aedes aegypti tRNA AAEL016282
  2. Aedes albopictus tRNA
  3. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011504.1
  4. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon UCU)
  5. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon UCU)
  6. Apis cerana cerana tRNA
  7. Apis dorsata tRNA-Arg
  8. Apis florea tRNA-Arg
  9. Apis mellifera tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  10. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005004351.1
  11. Bactrocera dorsalis (Oriental fruit fly) tRNA-Arg
  12. Bactrocera latifrons tRNA-Arg
  13. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon UCU)
  14. Bactrocera tryoni (Queensland fruitfly) tRNA-Arg
  15. Bombus affinis (Rusty patched bumble bee) transfer RNA arginine (anticodon UCU)
  16. Bombus huntii (Hunt's bumblebee) transfer RNA arginine (anticodon UCU)
  17. Bombus terrestris tRNA LOC110120165
  18. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Arg
  19. Bombus vosnesenskii tRNA
  20. Cephus cinctus (wheat stem sawfly) tRNA
  21. Ceratitis capitata (Mediterranean fruit fly) tRNA-Arg
  22. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015427.1
  23. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  24. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon UCU)
  25. Drosophila ananassae tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  26. Drosophila arizonae (Fruit fly) tRNA-Arg
  27. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon UCU)
  28. Drosophila bipectinata (Fruit fly) tRNA-Arg
  29. Drosophila busckii (Fruit fly) tRNA-Arg
  30. Drosophila elegans (Fruit fly) tRNA-Arg
  31. Drosophila erecta tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  32. Drosophila eugracilis (Fruit fly) tRNA-Arg
  33. Drosophila ficusphila (Fruit fly) tRNA-Arg
  34. Drosophila grimshawi tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  35. Drosophila guanche (Fruit fly) tRNA-Arg
  36. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon UCU)
  37. Drosophila hydei (Fruit fly) tRNA-Arg
  38. Drosophila innubila (Fruit fly) tRNA-Arg
  39. Drosophila kikkawai (Fruit fly) tRNA-Arg
  40. Drosophila mauritiana (Fruit fly) tRNA-Arg
  41. Drosophila melanogaster transfer RNA:Arginine-TCT 1-1 (Dmel_CR30254)
  42. Drosophila miranda (Fruit fly) tRNA-Arg
  43. Drosophila mojavensis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  44. Drosophila navojoa (Fruit fly) tRNA-Arg
  45. Drosophila obscura (Fruit fly) tRNA-Arg
  46. Drosophila persimilis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  47. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  48. Drosophila pseudoobscura pseudoobscura tRNA Dpse RNA:GA29559
  49. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  50. Drosophila santomea (Fruit fly) tRNA-Arg
  51. Drosophila sechellia tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  52. Drosophila simulans tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  53. Drosophila subobscura (Fruit fly) tRNA-Arg
  54. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  55. Drosophila suzukii (Fruit fly) tRNA-Arg
  56. Drosophila takahashii (Fruit fly) tRNA-Arg
  57. Drosophila teissieri (Fruit fly) tRNA-Arg
  58. Drosophila virilis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  59. Drosophila willistoni tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  60. Drosophila yakuba tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  61. Dufourea novaeangliae tRNA-Arg
  62. Eufriesea mexicana (Bee) tRNA-Arg
  63. Frieseomelitta varia tRNA
  64. Glossina austeni (Tsetse fly) tRNA tRNA-Arg
  65. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Arg
  66. Glossina fuscipes fuscipes tRNA
  67. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Arg
  68. Glossina pallidipes (Tsetse fly) tRNA tRNA-Arg
  69. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Arg
  70. Habropoda laboriosa tRNA-Arg
  71. Harpegnathos saltator tRNA-Arg
  72. Hermetia illucens tRNA-Arg
  73. Heterotrigona itama tRNA
  74. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA arginine (anticodon UCU)
  75. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA arginine (anticodon UCU)
  76. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005000603.1
  77. Ignelater luminosus (cucubano) tRNA
  78. Lucilia cuprina (Australian sheep blowfly) tRNA-Arg for anticodon UCU
  79. Lutzomyia longipalpis (Sand fly) tRNA tRNA-Arg
  80. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011426.1
  81. Megachile rotundata tRNA-Arg
  82. Melipona bicolor tRNA
  83. Melipona quadrifasciata tRNA
  84. Musca domestica (House fly) tRNA MDOA003218
  85. Ooceraea biroi tRNA-Arg
  86. Phlebotomus argentipes (Sand fly) transfer RNA arginine (anticodon UCU)
  87. Rhagoletis pomonella (Apple magot fly) tRNA-Arg
  88. Scaptodrosophila lebanonensis tRNA
  89. Schistocerca americana (American grasshopper) tRNA-Arg
  90. Schistocerca cancellata (South American locust) transfer RNA arginine (anticodon UCU)
  91. Schistocerca gregaria (Grasshoppers) transfer RNA arginine (anticodon UCU)
  92. Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCU)
  93. Schistocerca piceifrons (Central American locust) tRNA-Arg
  94. Schistocerca serialis cubense (Grasshoppers) transfer RNA arginine (anticodon UCU)
  95. Sergentomyia squamirostris tRNA-Arg
  96. Stomoxys calcitrans tRNA-Arg
  97. Venturia canescens (Endoparasitoid wasp) tRNA-Arg
  98. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon UCU)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...