Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-200b-3p URS000014D9C1_10090

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (TarBase, LncBase, PirBase, miRBase, ENA, RefSeq). Described in 40 papers. Mus musculus (house mouse) mmu-miR-200b-3p sequence is a product of miR-200b-3p, miR-200, miR-200b, mmu-miR-200b, Mir200b, mmu-miR-200b-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610010B06Rik, 0610041E09Rik, 0710005O05Rik, 107kDa, 1110012E16Rik, 1110047K16Rik, 1110059H06Rik, 1110067B02Rik, 1110069N15Rik, 1300002F13Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAUACUGCCUGGUAAUGAUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Anolis carolinensis aca-miR-200b-3p
    2. Callorhinchus milii eshark_mir-8_1
    3. Capra hircus chi-miR-200b
    4. Ciona savignyi csa-miR-200
    5. Cyprinus carpio (common carp) ccr-miR-200b
    6. Danio rerio (zebrafish) dre-miR-200b-3p
    7. Equus caballus eca-miR-200b
    8. Homo sapiens (human) hsa-miR-200b-3p
    9. Macaca fascicularis microRNA miR-200b-3p
    10. Monodelphis domestica mdo-miR-200b-3p
    11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63138
    12. Takifugu rubripes fru-miR-200b
    13. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200b
    14. Tor tambroides miR-200b-3p
    15. Tupaia chinensis tch-miR-200b-3p