Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Klebsiella pneumoniae subsp. pneumoniae KpQ3 5S ribosomal RNA secondary structure diagram

Klebsiella pneumoniae subsp. pneumoniae KpQ3 5S ribosomal RNA URS000014A6E1_1226115

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCGGCACUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGUGAGAGUAGGGAACUGCCAGGCAUCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Klebsiella pneumoniae subsp. pneumoniae MGH 78578 5S ribosomal RNA
2D structure