Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-342 URS0000148B91_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCACACAGAAAUCGCACCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Canis lupus familiaris cfa-miR-342
  2. Equus caballus eca-miR-342-3p
  3. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-167195
  4. Homo sapiens hsa-miR-342-3p
  5. Macaca mulatta (Rhesus monkey) mml-miR-342-3p
  6. Mus musculus (house mouse) mmu-miR-342-3p
  7. Pongo pygmaeus ppy-miR-342-3p
  8. Pteropus alecto (black flying fox) pal-miR-342-3p
  9. Rattus norvegicus rno-miR-342-3p
  10. Tupaia chinensis (Chinese tree shrew) tch-miR-342-3p
Publications