Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Staphylothermus hellenicus 16S ribosomal RNA secondary structure diagram

Staphylothermus hellenicus 16S ribosomal RNA URS0000148732_84599

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCCGGUUGAUCCUGCCGGACCCGACCGCUAUCGGGGUGGGGCUAAGCCAUGGGAGUCGUACGCUCCGCCGCUGCGGAGCGUGGCGGACGGCUGAGUAACACGUGGCUAACCUACCCUCGGGAGGGGGAUAACACCGGGAAACUGGUGCUAAUCCCCCAUAGGGGAGGACGCCUGGAAGGGUUCCUCCCCGAAAGGGUGCGGCGGGGGUUAUCGCCGCCGCGCAGCCCGAGGAUGGGGCUGCGGCCCAUCAGGUAGUUGGCGGGGUAACGGCCCGCCAAGCCGAUAACGGGUAGGGGCCGUGAGAGCGGGAGCCCCCAGAUGGGCACUGAGACAAGGGCCCAGGCCCUACGGGGUGCACCAGGCGCGAAACCUCCGCAAUGCGGGCAACCGUGACGGGGUCACCCCGAGUGCCCCCUAAUUAGGGGGCUUUUCCCCGCUGUAAGAAGGCGGGGGAAUAAGCGGGGGGCAAGACUGGUGUCAGCCGCCGCGGUAAUACCAGCCCCGCGAGUGGUCGGGACGAUUAUUGGGCCUAAAGCGCCCGUAGCCGGCCUGGCAAGUCCCCUCCUAAAUCCCCGGGCUCAACCCGGGGACUGGAGGGGAAACUGCCAGGCUAGGGGGCGGGAGAGGCCGAGGGUACUCCCGGGGUAGGGGCGAAAUCCUAUAAUCCCGGGAGGACCACCAGUGGCGAAGGCGCUCGGCUGGAACGCGCCCGACGGUGAGGGGCGAAAGCCGGGGGAGCGAACCGGAUUAGAUACCCGGGUAGUCCCGGCUGUAAACGAUGCGGGCUAGGUGUUGGGCGGGCUUAGAGCCCGCCCAGUGCCGCAGGGAAGCCGUUAAGCCCGCCGCCUGGGGAGUACGGCCGCAAGGCUGAAACUUAAAGGAAUUGGCGGGGGAGCACCACAAGGGGUGGAGCCUGCGGUUUAAUUGGAGUCAACGCCGGGAACCUCACCGGGGGCGACAGCAGGAUGACGGCCAGGCUAACGGCCUUGCCCGACGCGCUGAGAGGAGGUGCAUGGCCGUCGCCAGCUCGUGCCGUGAGGUGUCCGGUUAAGUCCGGCAACGAGCGAGACCCCCGCCCCUAGUUGCUACCCGGAGCUCCGGCUCCGGGGCACACUAGGGGGACUGCCGCCGUAUAAGGCGGAGGAAGGAGGGGGCCACGGCAGGUCAGCAUGCCCCGAAUCCCCCGGGCUACACGCGGGCUACAAUGGCGGGGACAGCGGGAUCCGACCCCGUAAGGGGGAGGCAAUCCCUCAAACCCCGCCGCAGUUGGGAUCGAGGGCUGCAACUCGCCCUCGUGAACGUGGAAUCCCUAGUAACCGCGCGUCAUCAUCGCGCGGUGAAUACGUCCCUGCUCCUUGCACACACCGCCCGUCGCUCCACCCGAGGGAGGGGGGAGUGAGGCCUGGUCUCCCGGGGAAACCCGGGGGGCCAGGUCGAACUCCCCCCUCCCAAGGGGGGAGAAGUCGUAACAAGGUAGCCGUAGGGGAACCUGCGGCUGGAUCACCUCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Staphylothermus hellenicus DSM 12710 bacterial SSU rRNA
2D structure