v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-136 URS0000147F3E_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUCCAUUUGUUUUGAUGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Capra hircus (goat) chi-miR-136-5p
  2. Eptesicus fuscus efu-miR-136
  3. Equus caballus eca-miR-136
  4. Homo sapiens (human) Hsa-Mir-136-v2_5p (mature (co-guide))
  5. Mus musculus (house mouse) mmu-miR-136-5p