Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Met (anticodon CAT) 1-1 (TRM-CAT1-1) secondary structure diagram

Homo sapiens (human) tRNA-Met (anticodon CAT) 1-1 (TRM-CAT1-1) URS0000145C5E_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUCGUUAGCGCAGUAGGUAGCGCGUCAGUCUCAUAAUCUGAAGGUCGUGAGUUCGAUCCUCACACGGGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 234 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  3. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  4. Albula goreensis tRNA-Met
  5. Alosa alosa (allis shad) tRNA-Met
  6. Amazona aestiva tRNA
  7. Ameiurus melas (black bullhead) tRNA-Met
  8. Anas platyrhynchos tRNA
  9. Anguilla anguilla tRNA-Met
  10. Apaloderma vittatum tRNA
  11. Aptenodytes forsteri (emperor penguin) tRNA
  12. Astyanax mexicanus (Mexican tetra) tRNA
  13. Balaenoptera acutorostrata scammoni tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  14. Balearica regulorum gibbericeps tRNA
  15. Bos taurus tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  16. Callipepla squamata tRNA
  17. Callithrix jacchus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  18. Calypte anna (Anna's hummingbird) tRNA
  19. Camelus ferus tRNA
  20. Antrostomus carolinensis tRNA
  21. Cathartes aura tRNA
  22. Cavia porcellus tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  23. Chaetura pelagica tRNA
  24. Charadrius vociferus tRNA
  25. Chelonia mydas tRNA
  26. Chelydra serpentina tRNA-Met
  27. Chlamydotis macqueenii tRNA
  28. Chlorocebus sabaeus tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  29. Chrysemys picta bellii tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  30. Colinus virginianus tRNA
  31. Colius striatus tRNA
  32. Columba livia tRNA
  33. Cordylochernes scorpioides tRNA-Met
  34. Corvus brachyrhynchos tRNA
  35. Cricetulus griseus tRNA-Met (CAT) (tRNA-Met-CAT-4-1)
  36. Danio rerio tRNA-Met (CAT) (tRNA-Met-CAT-4-1)
  37. Dasypus novemcinctus tRNA-Met (CAT) (tRNA-Met-CAT-2-1, tRNA-Met-CAT-2-2)
  38. Dipodomys ordii tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  39. Egretta garzetta tRNA
  40. Eptesicus nilssonii tRNA-Met
  41. Eschrichtius robustus tRNA-Met
  42. Eurypyga helias (sunbittern) tRNA
  43. Felis catus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  44. Ficedula albicollis tRNA
  45. Fukomys damarensis (Damara mole-rat) tRNA
  46. Gallus gallus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  47. Geospiza fortis tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  48. Gorilla gorilla gorilla tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  49. Heterocephalus glaber tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  50. Ictidomys tridecemlineatus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  51. Lamprotornis superbus tRNA-OTHER
  52. Latimeria chalumnae tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  53. Lepisosteus oculatus (spotted gar) tRNA
  54. Leptosomus discolor tRNA
  55. Lonchura striata domestica (Bengalese finch) tRNA
  56. Loxodonta africana tRNA-Met (CAT) (tRNA-Met-CAT-3-1)
  57. Lytechinus variegatus (Green sea urchin) tRNA-Met
  58. Macaca mulatta tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  59. Macrostomum lignano tRNA
  60. Manacus vitellinus (golden-collared manakin) tRNA
  61. Marmota monax (woodchuck) tRNA.Met
  62. Megalops atlanticus tRNA-Met
  63. Meleagris gallopavo tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  64. Melopsittacus undulatus tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  65. Mesitornis unicolor tRNA
  66. Mesocricetus auratus (golden hamster) tRNA
  67. Microcebus murinus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  68. Monodelphis domestica tRNA-Met (CAT) (tRNA-Met-CAT-2 1 to 3)
  69. Mus caroli tRNA-Met (CAT) (tRNA-Met-CAT-2-1, tRNA-Met-CAT-2-2)
  70. Mus musculus castaneus tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  71. Mus musculus domesticus tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  72. Mus musculus musculus tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  73. Mus musculus tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  74. Mus pahari tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  75. Mus spretus tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  76. Mustela putorius furo tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  77. Myotis brandtii tRNA
  78. Myotis davidii tRNA
  79. Myotis lucifugus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  80. Neotoma lepida tRNA
  81. Nestor notabilis tRNA
  82. Nipponia nippon tRNA
  83. Notamacropus eugenii tRNA-Met (CAT) (tRNA-Met-CAT-2-1, tRNA-Met-CAT-2-2)
  84. Ochotona princeps tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  85. Ornithorhynchus anatinus tRNA-Met (CAT) (tRNA-Met-CAT-3-1)
  86. Oryctolagus cuniculus tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  87. Ovis aries tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  88. Pangasianodon gigas (Mekong giant catfish) tRNA-Met
  89. Pangasianodon hypophthalmus tRNA-Met
  90. Pangasius djambal tRNA-Met
  91. Pan troglodytes tRNA-Met (CAT) (tRNA-Met-CAT-12-1)
  92. Papio anubis tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  93. Patagioenas fasciata monilis tRNA
  94. Pelecanus crispus tRNA
  95. Pelobates cultripes (western spadefoot toad) tRNA.Met
  96. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  97. Petromyzon marinus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  98. Phalacrocorax carbo (great cormorant) tRNA
  99. Phoenicopterus ruber ruber tRNA
  100. Dryobates pubescens tRNA
  101. Pongo abelii tRNA-Met (CAT) (tRNA-Met-CAT-8-1)
  102. Procavia capensis tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  103. Pterocles gutturalis tRNA
  104. Pteropus alecto tRNA
  105. Pygoscelis adeliae tRNA
  106. Rattus norvegicus tRNA-Met (CAT) (tRNA-Met-CAT-2-1, tRNA-Met-CAT-2-2)
  107. Saccoglossus kowalevskii (Acorn worm) tRNA-Met
  108. Saimiri boliviensis boliviensis tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  109. Salmo salar (Atlantic salmon) tRNA
  110. Sarcophilus harrisii tRNA-Met (CAT) (tRNA-Met-CAT-2 1 to 3)
  111. Scleropages formosus (Asian bonytongue) tRNA
  112. Sorex araneus tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  113. Struthio camelus australis tRNA
  114. Sus scrofa tRNA-Met (CAT) (tRNA-Met-CAT-3-1)
  115. Taeniopygia guttata tRNA-Met (CAT) (tRNA-Met-CAT-1-1, tRNA-Met-CAT-1-2)
  116. Tauraco erythrolophus tRNA
  117. Trichechus manatus latirostris tRNA-Met (CAT) (tRNA-Met-CAT-2-1)
  118. Tupaia chinensis tRNA
  119. Tursiops truncatus tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  120. Vicugna pacos tRNA-Met (CAT) (tRNA-Met-CAT-1-1)
  121. Xenopus laevis tRNA
  122. Xenopus tropicalis tRNA-Met (CAT) (tRNA-Met-CAT-1 1 to 60)
2D structure Publications