Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-22-5p URS0000142DC3_9913

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUUCUUCAGUGGCAAGCUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-22-5p
  2. Cervus elaphus cel-miR-22-5p
  3. Chrysemys picta (Painted turtle) cpi-miR-22-5p
  4. Columba livia cli-miR-22-5p
  5. Dasypus novemcinctus dno-miR-22-5p
  6. Gallus gallus gga-miR-22-5p
  7. Homo sapiens hsa-miR-22-5p
  8. Mus musculus mmu-miR-22-5p
  9. Ornithorhynchus anatinus (platypus) oan-miR-22-5p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-22-5p
  11. Pteropus alecto (black flying fox) pal-miR-22-5p
  12. Rattus norvegicus (Norway rat) rno-miR-22-5p
  13. Sus scrofa (pig) ssc-miR-22-5p
  14. Xenopus laevis (African clawed frog) Xla-Mir-22-P1b3_5p (mature (co-guide))
  15. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3763164
Publications