Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS000013DDAE_559292

mRNA interactions 12 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUUCAAUAAACUGAUCUUCCGGAUUACCAUGCUUAAGACAUCACGCCUCCAUAUGUCUAUAUAAAGCGCAAAUGGCUGGAAGUAGACCAAUUUUUUUUGUUCCUAGCUUUUCAUUAUUGAAAUCUAAUCCAGUUUUAAUGGUUUUUCUUAAUUAAGAAAACAAAUUAUCAUUGGUUCGCUCUAGGUGUACAUAUCUUCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 76 other species

  1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR5
  2. Saccharomyces cerevisiae Kyokai no. 7 K7_snR5
  3. Saccharomyces cerevisiae R103 SNR5
  4. Saccharomyces cerevisiae YJM1083 SNR5
  5. Saccharomyces cerevisiae YJM1133 SNR5
  6. Saccharomyces cerevisiae YJM1208 SNR5
  7. Saccharomyces cerevisiae YJM1248 SNR5
  8. Saccharomyces cerevisiae YJM1273 SNR5
  9. Saccharomyces cerevisiae YJM1326 SNR5
  10. Saccharomyces cerevisiae YJM1381 SNR5
  11. Saccharomyces cerevisiae YJM1385 SNR5
  12. Saccharomyces cerevisiae YJM1387 SNR5
  13. Saccharomyces cerevisiae YJM1388 SNR5
  14. Saccharomyces cerevisiae YJM1389 SNR5
  15. Saccharomyces cerevisiae YJM1400 SNR5
  16. Saccharomyces cerevisiae YJM1401 SNR5
  17. Saccharomyces cerevisiae YJM1402 SNR5
  18. Saccharomyces cerevisiae YJM1418 SNR5
  19. Saccharomyces cerevisiae YJM1434 SNR5
  20. Saccharomyces cerevisiae YJM1439 SNR5
  21. Saccharomyces cerevisiae YJM1443 SNR5
  22. Saccharomyces cerevisiae YJM1444 SNR5
  23. Saccharomyces cerevisiae YJM1450 SNR5
  24. Saccharomyces cerevisiae YJM1460 SNR5
  25. Saccharomyces cerevisiae YJM1479 SNR5
  26. Saccharomyces cerevisiae YJM1549 SNR5
  27. Saccharomyces cerevisiae YJM1573 SNR5
  28. Saccharomyces cerevisiae YJM1592 SNR5
  29. Saccharomyces cerevisiae YJM1615 SNR5
  30. Saccharomyces cerevisiae YJM195 SNR5
  31. Saccharomyces cerevisiae YJM320 SNR5
  32. Saccharomyces cerevisiae YJM326 SNR5
  33. Saccharomyces cerevisiae YJM428 SNR5
  34. Saccharomyces cerevisiae YJM541 SNR5
  35. Saccharomyces cerevisiae YJM554 SNR5
  36. Saccharomyces cerevisiae YJM627 SNR5
  37. Saccharomyces cerevisiae YJM682 SNR5
  38. Saccharomyces cerevisiae YJM693 SNR5
2D structure Publications