v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae Lalvin QA23 tRNA secondary structure diagram

Saccharomyces cerevisiae Lalvin QA23 tRNA URS000013D786_764098

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCUUGUUAGCUCAGUUGGUAGAGCGUUCGGCUUUUAAGCGUAUUUGCUUAAGCAAGGAUACCGAAAUGUCAGGGGUUCGAGCCCCCUAUGAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Saccharomyces cerevisiae AWRI796 tRNA
  2. Saccharomyces cerevisiae tK(TTT)GR1 - systematic name
  3. Saccharomyces cerevisiae EC1118 tRNA-Lys
  4. Saccharomyces cerevisiae FostersB tRNA
  5. Saccharomyces cerevisiae FostersO tRNA
  6. Saccharomyces cerevisiae P301 tRNA-Lys
  7. Saccharomyces cerevisiae R008 tRNA-Lys
  8. Saccharomyces cerevisiae R103 tRNA-Lys
  9. Saccharomyces cerevisiae RM11-1a tRNA-Lys
  10. Saccharomyces cerevisiae S288C tRNA-Lys
  11. Saccharomyces cerevisiae Vin13 tRNA
  12. Saccharomyces cerevisiae VL3 tRNA
  13. Saccharomyces pastorianus tRNA-Lys
 2D structure Publications