Homo sapiens (human) SYNPR antisense RNA 1 (SYNPR-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SYNPR antisense RNA 1 (SYNPR-AS1) URS000013C88D_9606

558 nucleotides
9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, NONCODE, RefSeq)
Found in 0 other species
27 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SYNPR-AS1: SYNPR-AS1 is a long non-coding RNA (lncRNA) that was investigated in a study comparing different groups, and no significant difference was found between them [PMC6859443]. In the same study, SYNPR-AS1 and OSCAR (mRNA) were identified as protective biomarkers [PMC7523091].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AACCUGGAUGUUGACGGGGCCACCUCUGAUCUUGUGAGGAACUAGUCGGCGAGCAAUUGCUGAAGCUGCAAAAGACUUCUGAAUUAACAAUGAAGAAUUCAGAGCAUCUUUUACUCUCGAACAAAAAGAACGCAGCUAACCAGAGACAACCAGUGGCUGAGCUGGGGCGUGAGGGCCCUGUCCUAUGGAUUUCUGAGCAGUGGUUCCAUGUGGCUUACCUGAGCUAUCCUGAGCUCAUCAAAGGACAGAAAUCUGCUGAGACCCUUGUUCUAAGUAUGUACUUUUCUUCCCAAGUCUCUUUAUUGAUAGGCACAACAGCUUGAAGAAACCAAAUGGACUGGAUGCCAAAAGCAACUUUGUGACCCCCUAUCAGAGGAAGUCAAGACUGGCAUUAACAGAGCCAAGACUGCAAGUGAUACAGCCUAGGCAUGUGUAACAGAAACAGCUUUGACCUCUAACAACAUCCAGAACCAAUGAUUCCUCCUCAUGGAACCAAGAAGAUGGGACAUGACCAGAACCUGCUGCAAUAUGACCGCCGGCACUCUUUCAAAGCAAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications