Pan troglodytes (chimpanzee) microRNA ptr-mir-216a precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) microRNA ptr-mir-216a precursor URS000013ABA3_9598

110 nucleotides
3 databases (ENA, Ensembl, miRBase)
Found in 9 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GAUGGCUGUGAGUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUCAUACAAUCCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUAGCCCUCACGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-216 (ENSGGOG00000038923.1, ENSGGOG00000042080.1)
Gorilla gorilla microRNA ggo-mir-216 precursor
Homo sapiens microRNA hsa-mir-216a precursor
Lemur catta microRNA lca-mir-216 precursor
Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-216 precursor