Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Halorubrum aidingense JCM 13560 16S ribosomal RNA secondary structure diagram

Halorubrum aidingense JCM 13560 16S ribosomal RNA URS0000139D38_1230454

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUCCGGUUGAUCCUGCCGGAGGCCAUUGCUAUUGGGAUUCGAUUUAGCCAUGCUAGUCGCACGAGUUCAGACUCGUGGCGAAUAGCUCAGUAACACGUGGCCAAACUACCCUUCGGAACACAAUACCCUCGGGAAACUGAGGCUAAUAGUGUAUACCGCAUCACACCUGGAAUGAGUGAUGCGCCAAACGCUCCGGCGCCGAAGGAUGUGGCUGCGGCCGAUUAGGUAGACGGUGGGGUAACGGCCCACCGUGCCAAUAAUCGGUACGGGUCAUGAGAGUGAGAACCCGGAGACGGAAUCUGAGACAAGAUUCCGGGCCCUACGGGGCGCAGCAGGCGCGAAACCUUUACACUGCACGACAGUGCGAUAAGGGAAUCCCAAGUGCGUAGGCAUAGAGCCUACGCUUUUGUCCACCGUAGGGAGGUGGACGAAUAAGGGCUGGGCAAGACCGGUGCCAGCCGCCGCGGUAAUACCGGCAGCCCGAGUGAUGGCCGAUCUUAUUGGGCCUAAAGCGUCCGUAGCUGGCCGCGCAAGUCUAUCGGAAAAUCCACCCGCUCAACGGGUGGGCGUCCGGUAGAAACUGCGUGGCUUGGGACCGGAAGGCGCGACGGGUACGUCCGGGGUAGGAGUGAAAUCCUGUAAUCCUGGACGGACCGCCGAUGGCGAAAGCACGUCGCGAAGACGGAUCCGACAGUGAGGGACGAAAGCUAGGGUCUCGAACCGGAUUAGAUACCCGGGUAGUCCUAGCCGUAAACAAUGCCUGUUAGGUGUGGCUCCCACUACGAGUGGGUGCUGUGCCGUAGGGAAGCCGCUAAACAGGCCGCCUGGGAAGUACGUCCGCAAGGAUGAAACUUAAAGGAAUUGGCGGGGGAGCACUACAACCGGAGGAGCCUGCGGUUUAAUUGGACUCAACGCCGGACAUCUCACCAGCAUCGACUGUAAUAAUGACGAUCAGGUUGAUGACCUUAUCCGAGUUUCAGAGAGGAGGUGCAUGGCCGCCGUCAGCUCGUACCGUGAGGCGUCCUGUUAAGUCAGGCAACGAGCGAGACCCGCAUCCUUACUUGCCAGCAGCACUGCGAAGUGGCUGGGGACAGUAGGGAGACCGCCGUGGCCAACACGGAGGAAGGAACGGGCAACGGUAGGUCAGUAUGCCCCGAAUGUGCUGGGCAACACGCGGGCUACAAUGGUCGAGACAAAGGGUUCCUACUCCGAAAGGAGACGGUAAUCUCAGAAACUCGAUCGUAGUUCGGAUUGUGGGCUGCAACUCGCCCACAUGAAGCUGGAUUCGGUAGUAAUCGCGUGUCAUAAGCGCGCGGUGAAUACGUCCCUGCUCCUUGCACACACCGCCCGUCAAAGCACCCGAGUGAGGUCCGGAUGAGGCUCGUUACACGAGUCGAAUCUGGGCUUCGCAAGGGGGCUUAAGUCGUAACAAGGUAGCCGUAGGGGAAUCUGCGGCUGGAUCACCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Halorubrum aidingense bacterial SSU rRNA
2D structure