Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlorocebus sabaeus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1) secondary structure diagram

Chlorocebus sabaeus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1) URS000013899F_60711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUCGUUAGUAUAGUGGUUAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCAAUUCCCCGACGGGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 63 other species

  1. Ailuropoda melanoleuca tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  3. Bos taurus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  4. Callithrix jacchus tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  5. Callorhinchus milii tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
  6. Camelus ferus (Wild Bactrian camel) tRNA
  7. Canis lupus familiaris tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  8. Carlito syrichta tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  9. Cavia porcellus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  10. Ceratotherium simum simum tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  11. Chelonia mydas tRNA
  12. Chelydra serpentina (Common snapping turtle) tRNA-Asp
  13. Choloepus hoffmanni tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  14. Chrysemys picta bellii tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  15. Cricetulus griseus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  16. Dasypus novemcinctus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  17. Dipodomys ordii tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  18. Eptesicus nilssonii tRNA-Asp
  19. Equus caballus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  20. Felis catus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  21. Fukomys damarensis tRNA
  22. Gorilla gorilla gorilla tRNA-Asp (GTC) (tRNA-Asp-GTC-5-1)
  23. Heterocephalus glaber tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  24. Homo sapiens tRNA-Asp (anticodon GTC) 1-1 (TRD-GTC1-1)
  25. Ictidomys tridecemlineatus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  26. Latimeria chalumnae tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  27. Loxodonta africana tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  28. Macaca mulatta tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  29. Marmota monax (woodchuck) tRNA.Asp
  30. Mesocricetus auratus (golden hamster) tRNA
  31. Microcebus murinus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  32. Mus caroli tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  33. Mus musculus domesticus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  34. Mus musculus musculus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  35. Mus musculus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-2-1)
  36. Mus pahari tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  37. Mus spretus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  38. Mustela putorius furo tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  39. Myotis brandtii tRNA
  40. Myotis davidii tRNA
  41. Myotis lucifugus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  42. Neotoma lepida (desert woodrat) tRNA
  43. Nomascus leucogenys tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  44. Ochotona princeps tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  45. Oryctolagus cuniculus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  46. Otolemur garnettii tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  47. Ovis aries tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  48. Pan troglodytes tRNA-Asp (GTC) (tRNA-Asp-GTC-3-1)
  49. Papio anubis tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  50. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  51. Pongo abelii tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  52. Pteropus alecto tRNA
  53. Rattus norvegicus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  54. Saimiri boliviensis boliviensis tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
  55. Salmo salar tRNA
  56. Sarcophilus harrisii tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-2)
  57. Sorex araneus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  58. Sus scrofa tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  59. Tupaia chinensis tRNA
  60. Tursiops truncatus tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
  61. Varroa destructor tRNA-Asp
  62. Varroa jacobsoni (Varroa mite) tRNA-Asp
  63. Vicugna pacos tRNA-Asp (GTC) (tRNA-Asp-GTC-1-1)
2D structure Publications