Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae S288C internal transcribed spacer URS000013305B_559292

Automated summary: This misc RNA sequence is 232 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 2 databases (SGD, PDBe). Described in 130 papers. Has an experimentally determined 3D structure. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCUUCUCAAACAUUCUGUUUGGUAGUGAGUGAUACUCUUUGGAGUUAACUUGAAAUUGCUGGCCUUUUCAUUGGAUGUUUUUUUUCCAAAGAGAGGUUUCUCUGCGUGCUUGAGGUAUAAUGCAAGUACGGUCGUUUUAGGUUUUACCAACUGCGGCUAAUCUUUUUUUAUACUGAGCGUAUUGGAACGUUAUCGAUAAGAAGAGAGCGUCUAGGCGAACAAUGUUCUUAAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Saccharomyces cerevisiae BY4741 ITS2 from Saccharomyces cerevisiae BY4741 (PDB 6C0F, chain 6)
    2. Saccharomyces cerevisiae ITS2 from Saccharomyces cerevisiae (PDB 6YLX, chain 6)
    3. Saccharomyces cerevisiae PE-2 ITS2-1
    4. Saccharomyces cerevisiae YJM1078 ITS2-13
    5. Saccharomyces cerevisiae YJM1129 ITS2-30
    6. Saccharomyces cerevisiae YJM1208 ITS2-134
    7. Saccharomyces cerevisiae YJM1242 ITS2-30
    8. Saccharomyces cerevisiae YJM1252 ITS2-103
    9. Saccharomyces cerevisiae YJM1311 ITS2-40
    10. Saccharomyces cerevisiae YJM1326 ITS2-40
    11. Saccharomyces cerevisiae YJM1332 ITS2-40
    12. Saccharomyces cerevisiae YJM1336 ITS2-104
    13. Saccharomyces cerevisiae YJM1338 ITS2-40
    14. Saccharomyces cerevisiae YJM1356 ITS2-104
    15. Saccharomyces cerevisiae YJM1381 ITS2-40
    16. Saccharomyces cerevisiae YJM1385 ITS2-104
    17. Saccharomyces cerevisiae YJM1450 ITS2-136
    18. Saccharomyces cerevisiae YJM1477 ITS2-30
    19. Saccharomyces cerevisiae YJM1526 ITS2-30
    20. Saccharomyces cerevisiae YJM1549 ITS2-103
    21. Saccharomyces cerevisiae YJM1615 ITS2-30
    22. Saccharomyces cerevisiae YJM189 ITS2-30
    23. Saccharomyces cerevisiae YJM248 ITS2-10
    24. Saccharomyces cerevisiae YJM320 ITS2-145
    25. Saccharomyces cerevisiae YJM428 ITS2-10
    26. Saccharomyces cerevisiae YJM453 ITS2-106
    27. Saccharomyces cerevisiae YJM541 ITS2-103
    28. Saccharomyces cerevisiae YJM554 ITS2-103
    29. Saccharomyces cerevisiae YJM555 ITS2-103
    30. Saccharomyces cerevisiae YJM682 ITS2-10
    31. Saccharomyces cerevisiae YJM683 ITS2-10
    32. Saccharomyces cerevisiae YJM693 ITS2-104
    33. Saccharomyces cerevisiae YJM969 ITS2-10
    34. Saccharomyces cerevisiae YJM972 ITS2-103
    35. Saccharomyces cerevisiae YJM975 ITS2-10
    36. Saccharomyces cerevisiae YJM978 ITS2-100
    37. Saccharomyces cerevisiae YJM984 ITS2-103
    38. Saccharomyces cerevisiae YJM987 ITS2-103
    39. Saccharomyces cerevisiae YJM993 ITS2-10
    40. Saccharomyces cerevisiae YJM996 ITS2-103