v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlamydia trachomatis L2b/UCH-1/proctitis 5S ribosomal RNA secondary structure diagram

Chlamydia trachomatis L2b/UCH-1/proctitis 5S ribosomal RNA URS000012E81A_471473

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUGGUGAUAAUAGAGAGAGGGAAACACCUGACACCAUUCCGAACUCAGAAGUUAAGCCUCUGAUCGCUGAUGGUACUAUACACAAGAGUAUGGGAGAGUAGGUCGUCGCCAAGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Chlamydia trachomatis 5S rRNA
  2. Chlamydia trachomatis D/UW-3/CX 5S ribosomal RNA
 2D structure