Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Serratia marcescens WW4 5S ribosomal RNA secondary structure diagram

Serratia marcescens WW4 5S ribosomal RNA URS000012DA94_435998

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCGGCAAUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGACACUGCCAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 60 other species

  1. Acinetobacter baumannii 5S ribosomal RNA
  2. Enterobacterales bacterium 8AC ribosomal RNA 5s ribosomal RNA
  3. Escherichia coli 5S ribosomal RNA
  4. Serratia entomophila 5S ribosomal RNA
  5. Serratia ficaria 5S ribosomal RNA
  6. Serratia fonticola 5S ribosomal RNA
  7. Serratia grimesii 5S ribosomal RNA
  8. Serratia liquefaciens 5S ribosomal RNA
  9. Serratia liquefaciens FK01 5S ribosomal RNA
  10. Serratia marcescens 5S rRNA
  11. Serratia marcescens BIDMC 44 5S ribosomal RNA
  12. Serratia marcescens BIDMC 50 5S ribosomal RNA
  13. Serratia marcescens BIDMC 80 5S ribosomal RNA
  14. Serratia marcescens BIDMC 81 5S ribosomal RNA
  15. Serratia marcescens SM39 5S rRNA
  16. Serratia marcescens subsp. marcescens Db11 rRNA
  17. Serratia odorifera 5S ribosomal RNA
  18. Serratia plymuthica 4Rx13 5S ribosomal RNA
  19. Serratia plymuthica 5S rRNA
  20. Serratia proteamaculans 5S ribosomal RNA
  21. Serratia quinivorans 5S ribosomal RNA
  22. Serratia rubidaea 5S ribosomal RNA
  23. Serratia sp. S119 5S ribosomal RNA
  24. Serratia sp. Tan611 ribosomal RNA 5s_rRNA
  25. Serratia ureilytica 5S ribosomal RNA
  26. Yersinia bercovieri 5S ribosomal RNA
  27. Yersinia enterocolitica 5S ribosomal RNA
  28. Yersinia frederiksenii 5S ribosomal RNA
  29. Yersinia pestis 5S ribosomal RNA
  30. Yersinia rohdei 5S ribosomal RNA
2D structure