Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Glycine max (soybean) gma-miR156k URS000012CD31_3847

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGACAGAAGAGAGUGAGCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Arabidopsis thaliana Ath_wt_01739
  2. Fragaria vesca subsp. vesca fve-miR156e
  3. Mus musculus Mus_musculus piRNA piR-mmu-50281777
  4. Populus trichocarpa ptr-MIR156e
  5. Prunus persica (peach) microRNA miRNA_277
Publications