Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548t-3p URS000012930C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-548aa: Hsa-mir-548aa is a miRNA that was identified through intersection analysis of differentially expressed miRNAs in patients with anaplastic thyroid carcinoma (ATC) [PMC9904904]. Among the three miRNAs found in the intersection analysis, only hsa-miR-143-3p showed significantly higher expression in ATC patients compared to normal controls [PMC9904904]. Hsa-mir-548aa is located on the sense strand of a genomic region, while hsa-mir-548d is located on the antisense strand, and their products can form a complementary miRNA:miRNA duplex [PMC3468316]. Hsa-mir-548aa and hsa-miR-548 t-3p are sense/antisense miRNAs that may or may not have location correlation [PMC3468316]. Hsa-mir-548aa has been associated with different cancer types, along with hsa-miR-1273d, hsa-miR-548 t-3p, and hsa-miR-1273 g-3p [PMC5629565]. In the context of specific gene mutations, hsa-mir-548aa has been predicted to target STK11 [PMC7999775]. Hsa-mir-548aa has also been identified as one of the top target miRNAs along with hsa-mir 548ap 3p, hsa mir 4288 and hsm mir 3138 [PMC6414176]. Additionally, there are specific entries for both hsm mir 548aa and has mir 548 t 3p in the miRBase database that have identical sequences and RNAcentral links [PMC8942954]. Finally, both circRNA variants (hsa_circ_0089761 and hsm_circ_0089763) share 26 identical miRNA targets, including hsa-mir-548aa [PMC9441041].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAACCACAAUUACUUUUGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications